Journal articles: 'Family Dog Productions' – Grafiati (2024)

  • Bibliography
  • Subscribe
  • News
  • Referencing guides Blog Automated transliteration Relevant bibliographies by topics

Log in

Українська Français Italiano Español Polski Português Deutsch

We are proudly a Ukrainian website. Our country was attacked by Russian Armed Forces on Feb. 24, 2022.
You can support the Ukrainian Army by following the link: https://u24.gov.ua/. Even the smallest donation is hugely appreciated!

Relevant bibliographies by topics / Family Dog Productions / Journal articles

To see the other types of publications on this topic, follow the link: Family Dog Productions.

Author: Grafiati

Published: 4 June 2021

Last updated: 15 February 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Consult the top 50 journal articles for your research on the topic 'Family Dog Productions.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Fortemaison,N., F.Miot, J.E.Dumont, and S.Dremier. "Regulation of H2O2 generation in thyroid cells does not involve Rac1 activation." European Journal of Endocrinology 152, no.1 (January 2005): 127–33. http://dx.doi.org/10.1530/eje.1.01815.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Objectives: The H2O2 generating system of the thyrocyte and the O2− generating system of macrophages and leukocytes present numerous functional analogies. The main constituent enzymes belong to the NADPH oxidase (NOX) family (Duox/ThOX for the thyroid and NOX2/gp91phox for the leukocytes and macrophages), and in both cell types, H2O2 generation is activated by the intra-cellular generation of Ca2+ and diacylglycerol signals. Nevertheless, although the controls involved in these two systems are similar, their mechanisms are different. The main factors controlling O2− production by NOX2 are the cytosolic proteins p67phox and p47phox, and Rac, a small GTP-binding protein. We have previously reported that there is no expression of p67phox and p47phox in thyrocytes. Here, we investigated whether Rac1 is an actor in the thyroid H2O2-generating system. Design and methods: Ionomycin- and carbamylcholine-stimulated H2O2 generation was measured in dog thyroid cells pretreated with the Clostridium difficile toxin B, which inhibits Rac proteins. Activation of Rac1 was measured in response to agents stimulating H2O2 production, using the CRIB domain of PAK1 as a probe in a glutathione S-transferase (GST) pull-down assay. Results: Among the various agents inducing H2O2 generation in dog thyrocytes, carbamylcholine is the only one which activates Rac1, whereas phorbol ester and calcium increase alone have no effect, and cAMP inactivates it. Moreover, whereas toxin B inhibits the stimulation of O2 generation by phorbol ester in leukocytes, it does not inhibit H2O2 generation induced by carbamylcholine and ionomycin in dog thyrocytes. Conclusions: Unlike in leukocytes, Rac proteins do not play a role in H2O2 generation in thyroid cells. A different regulatory cascade for the control of H2O2 generation remains to be defined.

2

Meurs, Kathryn, Steven Friedenberg, Natasha Olby, Julia Condit, Jess Weidman, Steve Rosenthal, and G.Shelton. "A QIL1 Variant Associated with Ventricular Arrhythmias and Sudden Cardiac Death in the Juvenile Rhodesian Ridgeback Dog." Genes 10, no.2 (February21, 2019): 168. http://dx.doi.org/10.3390/genes10020168.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The QIl1 gene produces a component of the Mitochondrial Contact Site and Cristae Organizing System that forms and stabilizes mitochondrial cristae junctions and is important in cellular energy production. We previously reported a family of Rhodesian Ridgebacks with cardiac arrhythmias and sudden cardiac death. Here, we performed whole genome sequencing on a trio from the family. Variant calling was performed using a standardized bioinformatics approach. Variants were filtered against variants from 247 dogs of 43 different breeds. High impact variants were validated against additional affected and unaffected dogs. A single missense G/A variant in the QIL1 gene was associated with the cardiac arrhythmia (p < 0.0001). The variant was predicted to change the amino acid from conserved Glycine to Serine and to be deleterious. Ultrastructural analysis of the biceps femoris muscle from an affected dog revealed hyperplastic mitochondria, cristae rearrangement, electron dense inclusions and lipid bodies. We identified a variant in the Q1l1 gene resulting in a mitochondrial cardiomyopathy characterized by cristae abnormalities and cardiac arrhythmias in a canine model. This natural animal model of mitochondrial cardiomyopathy provides a large animal model with which to study the development and progression of disease as well as genotypic phenotypic relationships.

3

Liu, Cheng-Hu, FabianaS.Machado, Rishu Guo, KimE.Nichols, A.WesleyBurks, JulioC.Aliberti, and Xiao-Ping Zhong. "Diacylglycerol kinase ζ regulates microbial recognition and host resistance to Toxoplasma gondii." Journal of Experimental Medicine 204, no.4 (March19, 2007): 781–92. http://dx.doi.org/10.1084/jem.20061856.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Mammalian Toll-like receptors (TLRs) recognize microbial pathogen-associated molecular patterns and are critical for innate immunity against microbial infection. Diacylglycerol (DAG) kinases (DGKs) regulate the intracellular levels of two important second messengers involved in signaling from many surface receptors by converting DAG to phosphatidic acid (PA). We demonstrate that the ζ isoform of the DGK family (DGKζ) is expressed in macrophages (Mφ) and dendritic cells. DGKζ deficiency results in impaired interleukin (IL) 12 and tumor necrosis factor α production following TLR stimulation in vitro and in vivo, increased resistance to endotoxin shock, and enhanced susceptibility to Toxoplasma gondii infection. We further show that DGKζ negatively controls the phosphatidylinositol 3–kinase (PI3K)–Akt pathway and that inhibition of PI3K activity or treatment with PA can restore lipopolysaccharide-induced IL-12 production by DGKζ-deficient Mφ. Collectively, our data provide the first genetic evidence that an enzyme involved in DAG/PA metabolism plays an important role in innate immunity and indicate that DGKζ promotes TLR responses via a pathway involving inhibition of PI3K.

4

DíazAñel,AlbertoM. "Phospholipase C β3 is a key component in the Gβγ/PKCη/PKD-mediated regulation of trans-Golgi network to plasma membrane transport." Biochemical Journal 406, no.1 (July26, 2007): 157–65. http://dx.doi.org/10.1042/bj20070359.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The requirement of DAG (diacylglycerol) to recruit PKD (protein kinase D) to the TGN (trans-Golgi network) for the targeting of transport carriers to the cell surface, has led us to a search for new components involved in this regulatory pathway. Previous findings reveal that the heterotrimeric Gβγ (GTP-binding protein βγ subunits) act as PKD activators, leading to fission of transport vesicles at the TGN. We have recently shown that PKCη (protein kinase Cη) functions as an intermediate member in the vesicle generating pathway. DAG is capable of activating this kinase at the TGN, and at the same time is able to recruit PKD to this organelle in order to interact with PKCη, allowing phosphorylation of PKD's activation loop. The most qualified candidates for the production of DAG at the TGN are PI-PLCs (phosphatidylinositol-specific phospholipases C), since some members of this family can be directly activated by Gβγ, utilizing PtdIns(4,5)P2 as a substrate, to produce the second messengers DAG and InsP3. In the present study we show that βγ-dependent Golgi fragmentation, PKD1 activation and TGN to plasma membrane transport were affected by a specific PI-PLC inhibitor, U73122 [1-(6-{[17-3-methoxyestra-1,3,5(10)-trien-17-yl]amino}hexyl)-1H-pyrrole-2,5-dione]. In addition, a recently described PI-PLC activator, m-3M3FBS [2,4,6-trimethyl-N-(m-3-trifluoromethylphenyl)benzenesulfonamide], induced vesiculation of the Golgi apparatus as well as PKD1 phosphorylation at its activation loop. Finally, using siRNA (small interfering RNA) to block several PI-PLCs, we were able to identify PLCβ3 as the sole member of this family involved in the regulation of the formation of transport carriers at the TGN. In conclusion, we demonstrate that fission of transport carriers at the TGN is dependent on PI-PLCs, specifically PLCβ3, which is necessary to activate PKCη and PKD in that Golgi compartment, via DAG production.

5

Fallahi, Parisa, Kasiviswanathan Muthukumarappan, KurtA.Rosentrater, and MichaelL.Brown. "Twin-screw Extrusion Processing of Vegetable-based Protein Feeds for Yellow Perch (Perca flavescens) Containing Distillers Dried Grains, Soy Protein Concentrate, and Fermented High Protein Soybean Meal." Journal of Food Research 1, no.3 (July17, 2012): 230. http://dx.doi.org/10.5539/jfr.v1n3p230.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

<span style="color: #800000; font-family: Times New Roman; font-size: small;"> </span><p class="MsoNormal" style="margin: 0in 0in 4pt; line-height: 12pt; mso-line-height-rule: exactly;">Changing to alternative protein sources supports production of more economic aquafeeds. Two isocaloric (3.06 kcal/g) and isonitrogenous (40% db) experimental feeds for juvenile yellow perch were formulated with incorporation of fermented soybean meal (FSBM) and soy protein concentrate (SPC), each of which were at two levels (0 and 20% db), along with constant amounts of high protein distillers dried grains (DDG) (~30% db), and appropriate amounts of other ingredients. Using a pilot scale twin-screw extruder, feed production was performed in two replications for each diet at conditioner steam levels of 0.11 to 0.16 kg/min, extruder water of 0.11 to 0.19 kg/min, and screw speeds of 230 to 300 rpm. The effects of SPC and FSBM<ins datetime="2012-07-09T13:59" cite="mailto:k"> </ins>inclusion on extrudate physical properties were compared with those of a control diet (which contained 20% fishmeal and ~30% DDG). Inclusion of 20% FSBM and 20%SPC resulted in a substantial decrease in unit density by 9.2 and 24%, but an increase in lightness, greenness, yellowness, and expansion ratio of the extrudates by 7, 27, 14, 7, 17, 34, 15, and 16.5%, respectively. SPC inclusion led to a considerable increase in water absorption, thermal resistivity, and thermal diffusivity by 17.5, 6.3, and 17.6%, respectively, whereas no significant change was observed for these properties with incorporation of 20% FSBM. Additionally, all extruded products had high durability. Taken together, using ~30% DDG with20% FSBM or20% SPC as alternative protein sources resulted in viable extrudates with properties appropriate for yellow perch production. A future study investigating the effect of extrusion processing conditions on the production of complete vegetable-based protein feeds for yellow perch species would be appropriate.</p><span style="color: #800000; font-family: Times New Roman; font-size: small;"> </span>

6

Li, Huaizhu, Lingling Dou, Wei Li, Ping Wang, Qin Zhao, Ruimin Xi, Xiaoyu Pei, Yangai Liu, and Zhongying Ren. "Genome-Wide Identification and Expression Analysis of the Dof Transcription Factor Gene Family in Gossypium hirsutum L." Agronomy 8, no.9 (September13, 2018): 186. http://dx.doi.org/10.3390/agronomy8090186.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Gossypium hirsutum L. is a worldwide economical crop; however, premature leaf senescence reduces its production and quality which is regulated by stresses, hormones, and genes. DNA binding with the one zinc finger (Dof) transcription factors (TFs) participate widely in plant development and responses to biotic and abiotic stresses, but there have been few reports of these TFs in cotton. Here, we perform a genome-wide study of G. Hirsutum L. Dof (GhDof) genes and analyze their phylogeny, duplication, and expression. In total, 114 GhDof genes have been identified and classified into nine subgroups (A, B1, B2.2, B2.1, C1, C2.1, C2.2, D1, and D2) based on phylogenetic analysis. An MCScanX analysis showed that the GhDof genes expanded due to segmental duplications. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis showed that GhDofD9.6 was not only differentially expressed between CCRI10 (with premature senescence) and Liao4086 (without premature senescence) but also responded to salinity stress; GhDofA5.7, GhDofA7.4, GhDofA8.2, GhDof11.1, GhDofD7.2, and GhDofD11.3 signfificantly responded to cold (4 °C) stress. This work lays the foundation for further analysis of the function of GhDof genes in G. hirsutum, which will be helpful for improving the production and quality of cotton.

7

Tratnik, Polona. "Maja Smrekar’s Biopolitical Manifesto from a Philosophical Perspective." Monitor ISH 19, no.2 (December4, 2017): 65–80. http://dx.doi.org/10.33700/1580-7118.19.2.65-80(2017).

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

With her series K-9_topology, Maja Smrekar is challenging anthropocentrism by linking biology and culture, in particular addressing interaction between human and animal species. The artist builds upon the recent scientific findings that it is not only the dog species that has been domesticated; the domestication that took place during evolution is to be considered mutual. Not only has the dog been mastered by the human, but dogs have had an active role in “using” the human species for a more comfortable survival as well. Both species coexist. In the project Ecce Canis Maja Smrekar built upon the sense of smell as an interface used to trigger the emotional connection between the species. Hybrid Family is another project in the K-9_topology series. In this performance Smrekar nurtured a puppy. By submitting herself to two and a half months of physiological training, she achieved milk production in her breasts. The artist refers to this process as to the process of becoming, of becoming-animal, becoming-woman and becoming m(Other). She is deeply rooted in her own experience at the beginning of the 3rd millennium, when “liberal capitalism finally struck hard into the newborn Slovenian economy”, as she writes in her blog: her parents lost their business, house, cars, forests, meadows and vineyards, and her father committed suicide. She finds her own way of resisting, which is in submitting herself to a “dog-human kinship relationship as a radical intimate action of ‘returning home’”. In the present paper, the process of becoming mother is analysed in relation to the process of becoming animal. Furthermore, the process of becoming (m)Other is particularly examined with reference to the mother-and-child unity, applying the Umwelt notion and a Hegelian, existentialist feminist and post-structuralist discussion of identity and difference. The process of becoming (m)Other is finally examined as a biopolitical statement or intervention with the investment of the artist’s body. Its purpose is to re-gain the position of power, i.e. to perform an act of resistance to bio-power on and through bodies.

8

Elmore,StevenW., Joy Bauch, RyanM.Fryer, Laurie Iciek, Kennan Marsh, SherryJ.Morgan, Richard Nelson, et al. "Bcl-2 Family Protein Inhibitors Induce a Unique Thrombocytopenia In Vivo." Blood 108, no.11 (November16, 2006): 4236. http://dx.doi.org/10.1182/blood.v108.11.4236.4236.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract We recently disclosed the discovery of ABT-737, a potent antagonist of antiapoptotic Bcl-2 family proteins that induced tumor regression in murine xenograft models. ABT-263 is a related, orally bioavailable Bcl-2 family protein inhibitor that is currently in clinical development. For both agents, multiple daily dosing from two to four weeks was well tolerated in all species evaluated. The primary preclinical toxicological finding in mouse, rat and dog was a unique thrombocytopenia characterized by a rapid clearance of circulating platelets. A series of in vivo studies that were performed to better characterize this phenomenon are described here. After a single intravenous or oral dose in dogs, circulating platelet counts decreased rapidly and concentration dependently with a nadir at approximately six hours post administration. Platelet counts returned to near normal levels within several days post dose, accompanied by an increase in both mean platelet volume and percent of reticulated platelets. Analysis of platelets by aggregometry during this rebound period indicated that returning platelets were fully functional. Following multiple doses, platelet counts also decreased rapidly after initial dosing, but exhibited evidence of rebound during the dosing period that appeared to be dose dependant. Evaluation of fibrinogen, d-dimer, antithrombin-III, PT and APTT did not support a mechanism involving consumptive coagulopathy. Whole body scintography utilizing [111] Indium labeled platelets in dogs indicated that platelet clearance after compound administration is primarily mediated by the liver. These data suggest that ABT-737 and ABT-263 preferentially affect circulating platelets rather than abrogating platelet production in the bone marrow. In fact, the observed rebound in platelet count in the face of continued dosing reflects the capacity for the animals to compensate for the effect. The enantiomer of ABT-737 (which has significantly lower activity against Bcl-2 family proteins) had no effect on circulating platelets in animals suggesting an underlying mechanism that is dependent on inhibition of antiapoptotic Bcl-2 family proteins. The unusually rapid kinetics of platelet clearance and recovery suggests that the drug-induced thrombocytopenia elicited by these Bcl-2 family protein inhibitors is unique compared to that observed with conventional cytotoxic chemotherapy.

9

TAN,K.H., A.ZUBAID, and T.H.KUNZ. "Food habits of Cynopterus brachyotis (Muller) (Chiroptera: Pteropodidau) in Peninsular Malaysia." Journal of Tropical Ecology 14, no.3 (May 1998): 299–307. http://dx.doi.org/10.1017/s0266467498000236.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Information on the feeding habits of the the lesser dog-faced friut bat, Cynopterus brachyotis, was obtained by the collection of food remains directly beneath daytime and feeding roosts. The bats were found to feed on the fruits of 54 plant species, the leaves of 14 species and the flower parts of four species. The seasonal phenological differences among congeneric plant species led to steady production of fruit throughout the year and the data suggets that Ficus spp. are a key component in the diet. Judging from its wide selection of fruits, C. brachyotis, is considered to be an important seed disperser. Folivory in C. brachyotis appears to be more common than previously thought. Of the leaves consumed by the bats, seven species belonged to the family Leguminosae, followed by Myrtaccae, Moraccae, Rhizophoacae and Euphorbiaccae. Friuts in general, provide an energy rich diet for phytophagous bats but most are low in protein. In contrast, leaves consumed by bats have a relatively high protein content. We suggest that folivory (by leaf fractionation) should be energetically more advantageous than the ingestion of large amounts of low protein friut or the active pursuit of mobile insects.

10

Rosningsih, Sonita. "PENERAPAN TEKNOLOGI MINI INTEGRATED FARMING SEBAGAI UPAYA PEMULIHAN EKONOMI DAN KETAHANAN PANGAN MASYARAKAT KORBAN GEMPA DI DESA ARGOREJO KECAMATAN SEDAYU KABUPATEN BANTUL." Caraka Tani: Journal of Sustainable Agriculture 25, no.1 (March1, 2010): 106. http://dx.doi.org/10.20961/carakatani.v25i1.15754.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

<p>Community service of the mini-integrated aplication program was done in the village of Argorejo, Sedayu, Bantul, Yogyakarta, on May to December 2009, aims to accelerate economic recovery and food avaibility of the earthquake-victim communities in Argorejo village. The group and individual approaches method used for implemented this program. 10 packages of local Hens and 10 packages vertikultur given to 10 selected participants (the status of young housewives) who later formed farmers' group called "Srikandi". Each package consists of 1 head of local co*ck and 10 local Hens is ready to lay their eggs. Guidance, training and strategy of setting chicken population, and cultivation vertikultur has been implemented . The results of the activities was established 10 poultry farmer who runs a semiintensive business. Vegetable crops are able to consumpt for family need, and vegetable waste for poultry feed. Most of the egg production use for family food needs. Now poultry and vertikultur farm are conscious cheap source of food for the family. Recent developments owned by members of the population groups currently are 100 local Hens, 11 head of co*ckl, 550 pullet, 300 DOC, 340 hatching eggs (being incubated).</p>

Lukefahr,S.D., P.R.Cheeke, J.I.McNitt, and N.M.Patton. "Limitations of intensive meat rabbit production in North America: A review." Canadian Journal of Animal Science 84, no.3 (September1, 2004): 349–60. http://dx.doi.org/10.4141/a04-002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

This paper documents underlying causes for the poor track record of the commercial meat rabbit industry in North America, relative to the success of several other species (cattle, swine, chickens and turkeys). For over half a century, efforts have been ongoing to develop a viable commercial meat rabbit industry. The progress has not been significant; rather, an accumulation of serious obstacles has targeted the species (e.g., high labor demand, no tradition of rabbit meat consumption, and nutritional limitations and behavioral constraints). Critical biological behaviors associated with the doe rabbit [e.g., short gestation and (or) underdeveloped neonates, cannibalism, territorialism, and pseudo-pregnancy] require that does be permanently placed into individual cages. These behaviors underpin the inability of management to offset labor by employing cost-effective automated feeding and management systems. As a consequence, labor costs per rabbit are high; rabbit meat is generally not competitive with more widely consumed meats. A proposed alternative solution is a redirected focus on rabbits as a “microlivestock” species — reared in small numbers as a family enterprise to enhance quality of life in rural and periurban areas, as well as in lesser developed countries — as opposed to further exploitation of the species as a commercial agricultural commodity. Key words: Rabbit, commercial, contemporary issues, industry, production

12

Hou, Huwei, Ya Hu, Qian Wang, Xiongbiao Xu, Yajuan Qian, and Xueping Zhou. "Gene Expression Profiling Shows That NbFDN1 Is Involved in Modulating the Hypersensitive Response-Like Cell Death Induced by the Oat dwarf virus RepA Protein." Molecular Plant-Microbe Interactions® 31, no.10 (October 2018): 1006–20. http://dx.doi.org/10.1094/mpmi-12-17-0291-r.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

In this study, we used high-throughput deep nucleotide sequencing to characterize the global transcriptional response of Nicotiana benthamiana plants to transient expression of the RepA protein from Oat dwarf virus (ODV). We identified 7,878 significantly differentially expressed genes (DEG) that mapped to 125 pathways, suggesting that comprehensive networks are involved in regulation of RepA-induced cell death. Of the 202 DEG associated with photosynthesis, expression of 195 was found to be downregulated, indicating a significant inhibition of photosynthesis in response to RepA expression, which is associated with chloroplast disruption and physiological changes. We focused our analysis on NbFDN1, a member of the ferredoxin protein family that participates in the chloroplast electron transport chain performing oxygenic photosynthesis, which was identified to directly interact with NbTsip1. We separately knocked down the expression of NbFDN1 and NbTsip1 using virus-induced gene silencing, and found that NbFDN1 silencing speeded up the development of RepA-induced cell death, unlike NbTsip1 silencing, which showed an opposite effect on RepA-induced response. Further study showed increased H2O2 accumulation and a negative correlation between the transcripts of NbFDN1 and NbTsip1 in NbFDN1-silenced plants. Hence, we speculate that NbFDN1 has an effect on RepA-induced hypersensitive response-like response by modulating NbTsip1 transcription as well as H2O2 production.

13

Purandare,AshokV., Animesh Pardanani, Theresa McDevitt, Marco Gottardis, Terra Lasho, Dan You, Louis Lombardo, et al. "Characterization of BMS-911543, a Functionally Selective Small Molecule Inhibitor of JAK2." Blood 116, no.21 (November19, 2010): 4112. http://dx.doi.org/10.1182/blood.v116.21.4112.4112.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract Abstract 4112 We report the characterization of BMS-911543, a potent and functionally selective small molecule inhibitor of the Janus kinase family (JAK) member, JAK2. BMS-911543 is a reversible inhibitor of JAK2 with a biochemical IC50 of 0.001 μ M and Ki of 0.48 nM. It has over 74- and 350-fold selectivity against the other JAK family members, JAK3 and JAK1, respectively. Further, examination of > 450 other kinases did not reveal significant inhibitory activity for this JAK2 inhibitor. Functionally, BMS-911543 displayed potent anti-proliferative and pharmacodynamic (PD) effects in mutated JAK2-expressing cell lines dependent upon JAK2-STAT signaling and had little activity in cell types dependent upon other pathways such as JAK1 and JAK3. BMS-911543 was evaluated in colony growth assays using primary progenitor cells isolated from patients with JAK2V617F-positive myeloproliferative disease (MPD) and resulted in an increased anti-proliferative response in MPD cells as compared with those from healthy volunteers. Similar to these in vitro observations, BMS-911543 was also highly active in in vivo models of JAK2-pSTAT signaling in multiple species (mouse, rat, dog and monkey) with sustained pathway suppression being observed after a single oral dose. Additionally, BMS-911543 was evaluated for effects in a JAK2V617F-expressing SET-2 xenograft model system and displayed a minimally effective dose of <2 mg/kg on pSTAT5 pathway suppression, which lasted up to 8 hours. BMS-911543 was also compared to pan-JAK inhibitors in a mouse model of immunosuppression. At low dose levels active in JAK2-dependent PD models, no effects were observed on antigen-induced IgG and IgM production whereas a pan-JAK family inhibitor showed pronounced effects at all dose levels tested. The mechanistic selectivity of BMS-911543 to pan-JAK family inhibitors was extended through comparative analysis of these inhibitors in whole genome gene expression profiling experiments performed in sensitive cell types. In this comparison, BMS-911543 modulated a distinct subset of transcriptional changes as compared to pan-JAK inhibitors, thereby defining a minimal set of transcriptional changes underlying the pharmacologic effects of JAK2 inhibition. Collectively these results define the mechanistic basis for a differential therapeutic index between selective JAK2 and pan-JAK family inhibition pre-clinically and suggest a therapeutic rationale for the further characterization of BMS-911543 in patients with MPD and in other disorders characterized by constitutively active JAK2 signaling. Disclosures: Purandare: Bristol-Myers Squibb: Employment. McDevitt:Bristol-Myers Squibb: Employment. Gottardis:Bristol-Myers Squibb: Employment. You:Bristol-Myers Squibb: Employment. Lombardo:Bristol_Myers Squibb: Employment. Penhallow:Bristol-Myers Squibb: Employment. Vuppugalla:Bristol-Myers Squibb: Employment. Trainor:Bristol-Myers Squibb: Employment. Lorenzi:Bristol-Myers Squibb: Employment.

14

Roura, Eugeni, Brooke Humphrey, Gemma Tedó, and Ignacio Ipharraguerre. "Unfolding the codes of short-term feed appetence in farm and companion animals. A comparative oronasal nutrient sensing biology review." Canadian Journal of Animal Science 88, no.4 (December1, 2008): 535–58. http://dx.doi.org/10.4141/cjas08014.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The evolution of the chemical senses has resulted in a sensory apparatus for high taste and smell acuity in mammals and birds to ensure self-nourishment. Such peripheral chemosensory systems function as a code to unfold the nutritional value of feedstuffs. Food ingestion simultaneously evokes odor, taste and thermo-mechanical (somatosensing) sensations. Olfaction represents the capacity to identify feed volatiles that are predominantly derived from essential nutrients in plants. Comparative biology of olfaction shows that primates and chickens have a smaller olfactory epithelium and fewer olfactory receptor (OR) genes than non-primate mammals studied to date including farm and companion animals, such as the pig, the cow, the dog, the cat and the horse. A significant proportion of the total OR genes in mammals and birds have lost their functionality (pseudogenes) in a process that seems to reflect a decrease in the animal’s reliance on the sense of smell, particularly in humans and cows. The taste system allows animals to recognize a diverse repertoire of nutrient (sugars, amino acids, salts, acids and fats) or toxic related chemical entities that provide valuable information about the quality of food. Taste senses non-volatile molecules in the oral cavity through taste receptors (TR). The TR are expressed in the sensory cells forming the taste buds of the tongue’s papillae. Taste cells are linked to a network of solitary chemosensory cells diffused through many non-taste tissues involved in metabolic homeostasis. The number of functional taste receptor genes (TASR) in humans is equivalent to that in other mammals and superior to that in chickens. The TASR family 1 (TAS1R coding for umami and sweet TR) is conserved, in number and type, across the species evaluated, with the exception of the sweet receptor in chicken and feline species. The TASR family 2 (TAS2R coding for bitter TR) shows a strong adaptive capacity to dietary sources and digestive physiology across vertebrates. Pseudogenization (loss of gene functionality) in the TAS2R family seems to be a frequent strategy. The implications of oronasal nutrient sensing related to comparative animal feeding strategies and behaviors such as neophobia, feed refusal and hedonic preferences are discussed. Feed palatability and appetence might be one of the main driving forces in short-term feed consumption. Finally, practical applications relevant to animal production are outlined. Key words: Nutrient sensing, taste, olfaction, somatosensing, feed intake, farm, companion animals

15

Viegas,RuiM.C., Elsa Mesquita, Margarida Campinas, and Maria João Rosa. "Pilot Studies and Cost Analysis of Hybrid Powdered Activated Carbon/Ceramic Microfiltration for Controlling Pharmaceutical Compounds and Organic Matter in Water Reclamation." Water 12, no.1 (December20, 2019): 33. http://dx.doi.org/10.3390/w12010033.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

This paper addresses the enhanced removal of pharmaceutical compounds (PhCs), a family of contaminants of emerging concern, and effluent organic matter (EfOM) in water reclamation by powdered activated carbon/coagulation/ceramic microfiltration (PAC/cMF). Four chemically diverse PhCs are targeted: ibuprofen (IBP), carbamazepine (CBZ), sulfamethoxazole (SMX) and atenolol (ATN). Pilot assays (100 L/(m2 h), 10 mg Fe/L) run with PhC-spiked sand-filtered secondary effluent and 15 mg/L PAC dosed in-line or to a 15-min contactor. They showed no PAC-driven membrane fouling and +15 to +18% added removal with PAC contactor, reaching significant removals of CBZ and ATN (59%–60%), SMX (50%), colour (48%), A254 (35%) and dissolved organic carbon (DOC, 28%). Earlier long-term demo tests with the same pilot proved PAC/cMF to consistently produce highly clarified (monthly median < 0.1 NTU) and bacteria-free water, regardless of the severe variations in its intake. A detailed cost analysis points to total production costs of 0.21 €/m3 for 50,000 m3/day and 20 years membrane lifespan, mainly associated to equipment/membranes replacement, capital and reagents.

16

David,V. "Up Close: Innovative Materials Development, Preparation, and Testing at Ames Laboratory." MRS Bulletin 12, no.5 (August 1987): 66–68. http://dx.doi.org/10.1557/s0883769400067609.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Ames Laboratory, operated by Iowa State University for the U.S. Department of Energy (DOE), was established in 1947 to conduct basic research with particular emphasis on new materials.Like the other national laboratories, Ames Laboratory was created in consequence of contributions made to the Manhattan Project. It was in Ames, early in World War II, that two college professors and a group of graduate students resolved a problem that had proved intractable to industry. Within months of Pearl Harbor, Frank Spedding and Harley Wilhelm devised a practical method for the large-scale production of pure uranium. While teaching industry how to do it, Ames furnished 1,000 tons of uranium for the Manhattan Project.In the postwar years, processes were developed at Ames Laboratory for the production of metals such thorium, vanadium, and chromium that were considered exotic at the time. The processes were adopted by industry and most are still in use today.Based on Spedding's earlier research, a pilot plant was built at Ames that produced 100-pound batches of the 15 rare earth elements in unprecedented purity. To tap a research source of 15 new metals, for these elements were hardly known before, would have been a triumph; but because each one in this family of the “fraternal fifteen” differs from its neighbor by a single electron, the research prospect revealed was virtually unbounded.

17

IMARISIO, Roberto, Paolo GIARDINA-PAPA, and Massimo SIRACUSA. "The new 1.3 L 90 PS diesel engine." Combustion Engines 122, no.3 (July1, 2005): 22–31. http://dx.doi.org/10.19206/ce-117397.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

After the start of mass production in April 2003 of a completely new Euro 4, 1.3 L, common rail Diesel engine, an upgraded variant has been recently developed, with power output increased from 70 to 90 PS and torque output increased from 180 to 200 N·m. To meet this target the combustion system has been deeply revised and common rail pressure increased from 1400 to 1600 bar, while maintaining the multiple injection feature already introduced on the 70 PS variant. Moreover, a variable geometry, small turbocharger has been specifically developed and the mechanical components upgraded to comply with an increased peak cylinder pressure from 140 to 160 bar. In order to comply with Euro 4 emission standards on critical applications with high load factors new control functions have been developed, in order to reduce the dispersion and the drift in durability, such as the lambda control based on an O2 sensor. In spite of Euro 4 emission compliance on most of the forecasted applications with conventional DOC after-treatment, a DPF version will be provided as well, adopting the maintenance free technology already applied on other engines with higher displacement. The 1.3 L SDE family is manufactured in Poland, in a plant located in Bielsko Biala, with an installed production capacity close to 700.000 engines per year.

18

McIntosh,AndrewF., and PhilipG.Cox. "The impact of gape on the performance of the skull in chisel-tooth digging and scratch digging mole-rats (Rodentia: Bathyergidae)." Royal Society Open Science 3, no.10 (October 2016): 160568. http://dx.doi.org/10.1098/rsos.160568.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The African mole-rats (Bathyergidae) are a family of rodents highly adapted for life underground. Previous research has shown that chisel-tooth digging mole-rats (which use their incisors to dig burrows) are clearly distinguishable from scratch diggers (which only use the forelimbs to tunnel) on the basis of morphology of the skull, and that the differences are linked to the production of high bite forces and wide gapes. We hypothesized that the skull of a chisel-tooth digging mole-rat would perform better at wider gapes than that of a scratch digging mole-rat during incisor biting. To test this hypothesis, we created finite-element models of the cranium of the scratch digging Bathyergus suillus and the chisel-tooth digging f*ckomys mechowii , and loaded them to simulate incisor bites at different gapes. Muscle loads were scaled such that the ratio of force to surface area was the same in both models. We measured three performance variables: overall stress across the cranium, mechanical efficiency of biting and degree of deformation across the skull. The f*ckomys model had a more efficient incisor bite at all gapes, despite having greater average stress across the skull. In addition, the f*ckomys model deformed less at wider gapes, whereas the Bathyergus model deformed less at narrower gapes. These properties of the cranial morphology of f*ckomys and Bathyergus are congruent with their respective chisel-tooth and scratch digging behaviours and, all other factors being equal, would enable the more efficient production of bite force at wider gapes in f*ckomys . However, in vivo measurements of muscle forces and activation patterns are needed to fully understand the complex biomechanics of tooth digging.

19

Chaves,R.N., A.M.C.V.Alves, L.F.Lima, H.M.T.Matos, A.P.R.Rodrigues, and J.R.Figueiredo. "Role of nerve growth factor (NGF) and its receptors in folliculogenesis." Zygote 21, no.2 (June1, 2012): 187–97. http://dx.doi.org/10.1017/s0967199412000111.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

SummaryNerve growth factor (NGF) is a prototype member of the neurotrophins family and has important functions in the maintenance of viability and proliferation of neuronal and non-neuronal cells, such as certain ovarian cells. The present review highlights the role of NGF and its receptors on ovarian follicle development. NGF initiates its multiple actions through binding to two classes of receptors: the high affinity receptor tyrosine kinase A (TrkA) and the low-affinity receptor p75. Different intracytoplasmic signalling pathways may be activated through binding to NGF due to variation in the receptors. The TrkA receptor activates predominantly phosphatidylinositol-3-kinase (PI3K) and mitogenic activated protein kinase (MAPK) to promote cell survival and proliferation. The activation of the phospholipase type Cγ (PLCγ) pathway, which results in the production of diacylglycerol (DAG) and inositol triphosphate (IP3), culminates in the release of calcium from the intracytoplasmic cellular stocks. However, the details of activation through p75 receptor are less well known. Expression of NGF and its receptors is localized in ovarian cells (oocyte, granulosa, theca and interstitial cells) from several species, which suggests that NGF and its receptors may regulate some ovarian functions such as follicular survival or development. Thus, the use of NGF in culture medium for ovarian follicles may be of critical importance for researchers who want to promote follicular developmentin vitroin the future.

20

Kawagoe, Tatsukata, Shintaro Sato, Andreas Jung, Masahiro Yamamoto, Kosuke Matsui, Hiroki Kato, Satoshi Uematsu, Osamu Takeuchi, and Shizuo Akira. "Essential role of IRAK-4 protein and its kinase activity in Toll-like receptor–mediated immune responses but not in TCR signaling." Journal of Experimental Medicine 204, no.5 (May7, 2007): 1013–24. http://dx.doi.org/10.1084/jem.20061523.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Interleukin-1 receptor–associated kinase 4 (IRAK-4) was reported to be essential for the Toll-like receptor (TLR)– and T cell receptor (TCR)–mediated signaling leading to the activation of nuclear factor κB (NF-κB). However, the importance of kinase activity of IRAK family members is unclear. In this study, we investigated the functional role of IRAK-4 activity in vivo by generating mice carrying a knockin mutation (KK213AA) that abrogates its kinase activity. IRAK-4KN/KN mice were highly resistant to TLR-induced shock response. The cytokine production in response to TLR ligands was severely impaired in IRAK-4KN/KN as well as IRAK-4−/− macrophages. The IRAK-4 activity was essential for the activation of signaling pathways leading to mitogen-activated protein kinases. TLR-induced IRAK-4/IRAK-1–dependent and –independent pathways were involved in early induction of NF-κB–regulated genes in response to TLR ligands such as tumor necrosis factor α and IκBζ. In contrast to a previous paper (Suzuki, N., S. Suzuki, D.G. Millar, M. Unno, H. Hara, T. Calzascia, S. Yamasaki, T. Yokosuka, N.J. Chen, A.R. Elford, et al. 2006. Science. 311:1927–1932), the TCR signaling was not impaired in IRAK-4−/− and IRAK-4KN/KN mice. Thus, the kinase activity of IRAK-4 is essential for the regulation of TLR-mediated innate immune responses.

21

Graves, Scott Stoll, Masahiko Sato, Carol Loretz, Stone Diane, and Rainer Storb. "Inducible Costimulator (ICOS) Is up-Regulated in Dogs with Graft Versus Host Disease and Graft Rejection Following Non-Identical Hematopoietic Cell Transplantation." Blood 120, no.21 (November16, 2012): 4109. http://dx.doi.org/10.1182/blood.v120.21.4109.4109.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract Abstract 4109 Inducible co-stimulator (ICOS), a member of the CD28 family of costimulatory molecules, is induced on CD4+ and CD8+ T-cells following their activation. Evidence suggests ICOS functions as an essential immune regulator and ICOS blockade is a potential target for allogeneic transplantation. We have used the canine model to develop several strategies for hematopoietic stem cell transplantation that have been successfully translated into the clinic. Here we describe the production and testing of monoclonal antibodies (mAb) directed against canine ICOS and determined the expression profile of ICOS in dogs. Canine ICOS was expressed in an inducible pattern on up to 89% of T-cells activated by Con A, anti-CD3 plus anti-CD28 mAb and alloantigen stimulation. Immunosuppressive effects of ICOS blockade were observed in mixed lymphocyte reactions (MLR) using peripheral blood mononuclear cells obtained from dog leukocyte antigen nonidentical dogs. Significant augmentation of the immunosuppressive effects of ICOS blockade was observed in MLR when anti-ICOS was combined with suboptimal concentrations of cytotoxic T-lymphocyte antigen 4-Ig (CTLA4-Ig) or cyclosporine. ICOS expression was significantly up-regulated on T-cells collected from the peripheral blood, lymph nodes and spleen from dogs undergoing graft rejection or chronic graft-versus-host disease after allogeneic hematopoietic stem cell transplantation. Dogs that remained mixed chimeric expressed ICOS at levels comparable to normal dogs. Analysis of the peripheral blood CD3+ T-cells isolated from dogs showed a significant up-regulation of ICOS expression 3 days but not 6–7 days before the diagnosis of chronic GVHD. Pharmaco*kinetic studies of 123I-labled anti-canine ICOS showed normal blood clearance profiles. These studies demonstrated that an antagonistic anti-canine ICOS mAb may have application in the prevention or treatment of GVHD in an outbred animal model shown to reliably translate novel hematopoietic cell transplantation therapies to the clinic. Disclosures: No relevant conflicts of interest to declare.

22

Palanichelvam, Karuppaiah, Philippe Oger, StevenJ.Clough, Chung Cha, AndrewF.Bent, and StephenK.Farrand. "A Second T-Region of the Soybean-Supervirulent Chrysopine-Type Ti Plasmid pTiChry5, and Construction of a Fully Disarmed vir Helper Plasmid." Molecular Plant-Microbe Interactions® 13, no.10 (October 2000): 1081–91. http://dx.doi.org/10.1094/mpmi.2000.13.10.1081.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Agrobacterium tumefaciens Chry5, which is particularly virulent on soybeans, induces tumors that produce a family of Amadori-type opines that includes deoxyfructosyl glutamine (Dfg) and its lactone, chrysopine (Chy). Cosmid clones mapping to the right of the known oncogenic T-region of pTiChry5 conferred Amadori opine production on tumors induced by the nopaline strain C58. Sequence analysis of DNA held in common among these cosmids identified two 25-bp, direct repeats flanking an 8.5-kb segment of pTiChry5. These probable border sequences are closely related to those of other known T-regions and define a second T-region of pTiChry5, called T-right (TR), that confers production of the Amadori opines. The oncogenic T-left region (TL) was located precisely by identifying and sequencing the likely border repeats defining this segment. The two T-regions are separated by approximately 15 kb of plasmid DNA. Based on these results, we predicted that pKYRT1, a vir helper plasmid derived from pTiChry5, still contains all of TR and the leftmost 9 kb of TL. Consistent with this hypothesis, transgenic Arabidopsis thaliana plants selected for with a marker encoded by a binary plasmid following transformation with KYRT1 coinherited production of the Amadori opines at high frequency. All opine-positive transgenic plants also contained TR-DNA, while those plants that lacked TR-DNA failed to produce the opines. Moreover, A. thaliana infected with KYRT1 in which an nptII gene driven by the 35S promoter of Cauliflower mosaic virus was inserted directly into the vir helper plasmid yielded kanamycin-resistant transformants at a low but detectable frequency. These results demonstrate that pKYRT1 is not disarmed, and can transfer Ti plasmid DNA to plants. A new vir helper plasmid was constructed from pTiChry5 by two rounds of sacB-mediated selection for deletion events. This plasmid, called pKPSF2, lacks both of the known T-regions and their borders. pKPSF2 failed to transfer Ti plasmid DNA to plants, but mobilized the T-region of a binary plasmid at an efficiency indistinguishable from those of pKYRT1 and the nopaline-type vir helper plasmid pMP90.

23

Babić, Jelena, and Nikolina Novakov. "ACQUAINTANCE OF TEMERIN CITIZENS WITH ECHINOCOCOSIS AS THE CURRENT ISSUE." Archives of Veterinary Medicine 6, no.1 (September6, 2013): 81–88. http://dx.doi.org/10.46784/e-avm.v6i1.147.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Echinococcosis is a zoonotic parasitic disease spread worldwide. The causative agent of the disease is a tapeworm Echinococcus spp.. Primary hosts are animals from the family Canidae and rarely Felidae and intermediate hosts are humans as well as domestic and wild ungulates. In Serbia, incidence of echinococcosis is a particularly high, which is due to poor education of pig breeders, inadequate production practice and lack of appropriate zoohygienic conditions and animal waste management. Pigs are among the major intermediate hosts of Echinococcus in Temerin, and people are most frequently affected during the periods of pig slaughter (lungs and liver are affected by the metacestode stage of Echinococcus). The primary host becomes infected by consuming infested organs, whilst an intermediate host becomes infected by oral intake of eggs excreted by the primary host in the feces. During pork examination for trichinosis at the veterinary clinic “BMV”, the customers reported cystic changes in the liver and lungs. Moreover, massive echinococcosis was diagnosed on the farm in pigs at slaughter. Very often, when noticing such changes in the organs, consumers tend to throw them away to dogs. Most likely, the citizens are poorly informed about the echinococcosis and its potential consequences. The aim of this research is to establish how much the citizens of Temerin municipality are informed about echinococcosis and to properly inform pig breeders that keeping dogs and pigs in cohabitation may enable direct transmission of parasites from defi nitive to intermediate hosts. Data were collected by using pre-formulated questionnaire. Te questionnaire was completed by 100 randomly selected people, and the results were statistically analyzed. Only 21% of respondents consider that they are acquainted with echinococcosis, and among them, every third person properly manages cystic organs suspect for echinococcosis. Forty-four respondents in Temerin municipality had an opportunity to see aff ected organs during pig slaughter, but only 14 of them acted correctly, while only 22.73% knew that a man could get infected from dogs. Of the entire sample population, 50 respondents had a dog, and only 13 of them regularly apply helminth eradication measures. The results obtained according to respondents’ answers indicated very sparse knowledge on this issue among Temerin citizens, strongly suggesting the need for an appropriate education strategy.

24

Ellis, Jessie, Xueyan Fu, J.PhilipKarl, Patrick Radcliffe, Jason Soares, Laurel Doherty, Christopher Hernandez, Joel Mason, Angela Oliverio, and Sarah Booth. "Investigation of Vitamin K Quinone Metabolism by Human Gut Bacteria." Current Developments in Nutrition 4, Supplement_2 (May29, 2020): 392. http://dx.doi.org/10.1093/cdn/nzaa045_025.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract Objectives Vitamin K (VK) is a family of structurally-related quinones, phylloquinone (PK) and menaquinones (MKn, n = prenyl units in side chain), that share a common napthoquinone ring (menadione, MD). VK quinones function as an essential dietary nutrient for humans. MD is considered a pro-vitamin form of VK. Plants and bacteria that produce VK quinones (PK and MKn, respectively) use them as an electron carrier in energy production. Little is known about the interaction of dietary VK quinones with gut bacteria, which may be bi-directional. The objective of this study was to investigate the influence of VK quinones and MD on human gut bacteria composition and MKn production. Methods Stool from 5 healthy male donors was pooled and inoculated in bioreactors under conditions mimicking the colon (anaerobic, pH 6.8, 37°C) for 48 h. Bioreactors were treated with deuterium (2H)-labeled quinones (2H-PK, 2H-MK4, 2H-MK9 or 2H-MD); no quinones (cell controls); or 2H-quinone treatment with no stool (cell-free controls). Culture aliquots were collected at 0, 5, 10, 24, and 48 h, and separated into pellet and supernatant fractions. Experiments were conducted in triplicate. All fractions were analyzed for VK quinone content using LC-MS. DNA from 0 and 24 h pellet fractions was extracted and amplified for paired-end 16S sequencing on an Illumina MiSeq 2500. Differences in bacterial composition were assessed using PERMANOVA. Results Supplemented 2H-quinones accumulated in the pellet fraction over time. This was not observed in cell-free controls and was thus not a function of culture media solubility. Endogenous (unlabeled) production of MKn was unaffected by supplementation of 2H-quinones. Generated 2H-MKn (2H-MK4, 2H-MK9, 2H-MK10, and 2H-MK11) were only detected in 2H-MD supplemented vessels. Community-wide bacterial composition significantly differed between 0 h and 24 h (r2 = 0.85, P = 0.001), but not by quinone treatment. Conclusions PK and MKn, dietary viamin K quinones, were not transformed by gut microbes to MKn in vitro, whereas the pro-vitamin quinone MD was transformed to MKn of multiple side chain lengths. Although no quinone induced community-wide changes in bacteria composition, additional analyses are needed to assess species-specific growth promotion. Funding Sources USDA ARS and DOD Health Program.

25

Li, Yueying, Chen Jin, Hao Bai, Shu Sun, PaulP.Liu, Linzhao Cheng, and Qianfei Wang. "Human NOTCH4 Is a Key Target of RUNX1 in Megakaryocytic Differentiation." Blood 128, no.22 (December2, 2016): 425. http://dx.doi.org/10.1182/blood.v128.22.425.425.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract Megakaryocytes (MK), which produce platelets, play important roles in blood coagulation and hemostasis. The master transcription factor RUNX1 regulates lineage-specific transcriptional targets and key signaling pathways, and is known to be essential for megakaryopoiesis. Mono-allelic RUNX1 mutations lead to familial platelet disorder (FPD), which is characterized by thrombocytopenia and abnormal platelet functions. A high percentage (~50%) of these FPD patients later develop myelodysplastic syndromes and acute myeloid leukemia. The exact mechanisms underlying deregulated megakaryopoiesis in FPD remain unclear, partially due to the lack of an adequate experimental model mimicking the human disease. For example, engineered laboratory mice and zebrafish with only one copy of the Runx1 gene do not develop bleeding disorders or leukemia. Using an in vitro hematopoietic differentiation system, we found that megakaryocytic differentiation from FPD-derived induced pluripotent stem cells (iPSCs) were defective (Connelly et al., 2014). Targeted correction of the mutated RUNX1 allele by genome editing restored the MK production and functions, validating the central role of RUNX1 in megakaryopoiesis (Connelly et al., 2014). In this new study, we pursued the hypothesis that direct target genes regulated by RUNX1 play important roles in human megakaryopoiesis. We first performed RNA-Seq analysis on differentiated hematopoietic cells from FPD-iPSCs (harboring a mono-allelic RUNX1 mutation) and RUNX1-corrected isogenic iPSCs. Seventy-nine genes were expressed at a significantly higher level (p<0.01, FDR<0.05) while 93 genes were expressed at a significantly lower level (p<0.01, FDR<0.05) in the RUNX1-corrected cells as compared to the FPD-iPSCs. To determine whether these differentially expressed genes (DEGs) are the direct targets of RUNX1, we additionally performed genome-wide location analysis of RUNX1 by ChIP-Seq using the same hematopoietic cell population differentiated from the RUNX1-corrected isogenic iPSCs. We detected 5266 (FDR<0.05) binding sites in 4526 gene loci. Combined with the DEG data from RNA-Seq analyses, we further identified 37 up-regulated genes (such as ITGB3 and PF4) and 27 down-regulated genes with RUNX1 binding to the gene's proximity. Among the 64 differentially expressed genes with RUNX1 binding, Gene Ontology (GO) analysis revealed that only 13 genes including PF4 have been reported to be relevant to megakaryopoiesis. In order to verify the roles of these RUNX1 target genes in hematopoiesis and megakaryopoiesis, we carried out gene knockout (KO) experiments by CRISPR-Cas9 in normal human iPSCs followed by in vitro hematopoietic differentiation assays. We first focused on the "down-regulated" genes by RUNX1 binding, with the hypothesis that their KO may enhance hematopoiesis and/or megakaryopoiesis from normal iPSCs. One of such genes is NOTCH4, a member of NOTCH receptor family that plays important roles in development and cell fate determination. A previous study showed that NOTCH signaling specifies MK development from mouse hematopoietic progenitor cells (Mercher et al., 2008), while we have not seen publications on the NOTCH4 in human MK development. Using the improved CRISPR technology, we successfully achieved KO of one copy of NOTCH4 in the wildtype iPSCs. We found that heterozygous KO of NOTCH4 increased MK (progenitor) production by 95% (p<0.05), while the production of CD34+ multipotent hematopoietic progenitor cells were not affected. To further verify its function, we inhibited NOTCH4 signaling with a gamma-secretase inhibitor. Notably, inhibition of NOTCH4 signal starting at day 2 of hematopoietic differentiation improved the efficiency of MK progenitor production by 50% (p<0.05) and more mature MK production by 70% (p<0.05). Taken together, we conclude that NOTCH4, a newly discovered RUNX1 target gene, negatively regulates megakaryopoiesis in a developmental-stage specific manner. Unlocking this inhibitory effect by small molecule inhibitors can promote MK production ex vivo. The described approach will enable us to discover additional novel genes that influence human hematopoiesis and megakaryopoiesis, which in turn will help to promote ex vivo generation of MKs from human iPSCs or postnatal hematopoietic stem/progenitor cells. Disclosures No relevant conflicts of interest to declare.

26

BaniHashemian,S.M., H.Taheri, N.Duran-Vila, and P.Serra. "First Report of Citrus viroid V in Moro Blood Sweet Orange in Iran." Plant Disease 94, no.1 (January 2010): 129. http://dx.doi.org/10.1094/pdis-94-1-0129a.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Viroids are nonencapsidated, small, circular, single-stranded RNAs that replicate autonomously when inoculated in their host plants in which they may elicit diseases (sensitive hosts) or replicate as latent infections (tolerant hosts). Citrus viroid V (CVd-V) was initially identified in Spain (1) and later found to be present in the United States, Nepal, and the Sultanate of Oman (2). CVd-V is a member of the Apscaviroid genus within the Pospiviroidae family. Like other members of this genus, CVd-V has a restricted host range but it is able to infect a wide range of citrus and citrus related species (1,2). Within the framework of a comprehensive survey of the sanitary status of the citrus industry in Iran, a sample from a private orchard of symptomless Moro blood sweet orange (Citrus sinensis) trees grafted on Mexican lime (C. aurantifolia) located at Javanan in the southern inland region was found to be infected with CVd-V. Briefly, RNAs of nucleic acid preparations from bark tissues were separated by 5% polyacrylamide gel electrophoresis (PAGE), electrotransferred to positively charged nylon membranes, immobilized by UV cross-linking, and hybridized with a full length CVd-V specific digoxigenin (DIG)-labeled DNA probe (2). A positive identification of CVd-V was made in these extracts. This positive detection of CVd-V was confirmed by reverse transcription-PCR using CVd-V specific primers of opposite polarity (5′-GACGAAGGCCGGTGAGCAGTAAGCC-3′) and (5′-GACGACGACAGGTGAGTACTTTC-3′) corresponding to CVd-V positions 90 to 114 and 69 to 89, respectively. Analysis of the sequence of the 293-bp amplicon (Genbank Accession No. GQ466068) revealed 99% identity with the reference sequence (Genbank Accession No. NC010165) of CVd-V. The rod-like predicted minimum free energy secondary structure of this new variant has 68.3% paired nucleotides. The changes with respect to the reference CVd-V variant are: (i) a deletion (48→-U) located in a loop of the V domain; (ii) a substitution (155A→C) located in a loop of the TR domain of the viroid secondary structure; and (iii) two compensatory substitutions located in the upper (46A→G) and lower (244U→C) strands of the viroid secondary structure. As shown earlier, the genome of CVd-V allows little variation with a large loop located in the segment I of the secondary structure (2) being the most amenable for mutations/changes. Among the viroids that have been found naturally infecting citrus, the members of the genus Apscaviroid are not associated with specific diseases but they cause a reduction of tree size and fruit harvest (3), an effect that is enhanced when several viroids coinfect the same plant (4). Therefore, the presence of CVd-V should be considered in further indexing tests aimed at the production and distribution of pathogen-free plants in Iran. References: (1) P. Serra et al. Virology 370:102, 2008. (2) P. Serra et al. Phytopathology 98:1199, 2008. (3) C. Vernière et al. Plant Dis. 88:1189, 2004. (4) C. Vernière et al. Phytopathology 96:356, 2006.

27

Oparina,N., M.Erlandsson, V.Chandrasekaran, K.M.Andersson, A.Damdimopoulos, S.TöyräSilfverswärd, G.Katona, and M.I.Bokarewa. "POS0360 COMPLEX LANDSCAPE OF BIRC5/SURVIVIN GENOME BINDING IN HUMAN CD4+ T CELLS." Annals of the Rheumatic Diseases 80, Suppl 1 (May19, 2021): 410.2–410. http://dx.doi.org/10.1136/annrheumdis-2021-eular.3708.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Background:Survivin, coded by BIRC5 gene, is a multitasking protein essential for cell renewal and homeostasis. In autoimmune conditions as rheumatoid and psoriasis arthritis, survivin was associated with inflammation severity and joint damage. Importantly, inhibition of survivin alleviated experimental arthritis in mice. We have recently shown survivin to be essential for T cell differentiation and micro-RNA processing. The known anti-apoptotic and proliferation facilitating functions of survivin does not explain the nuclear localization of survivin in interphase.Objectives:We aimed to uncover nuclear functions of BIRC5/survivin in CD4 cell of RA patients and healthy.Methods:CD4 T cells were isolated from the peripheral blood using positive selection on magnetic beads (EasySep) and activated for 48h with ConA+LPS. Chromatin immunoprecipitation (ChIP) with polyclonal anti-survivin antibodies was done in four independent samples of healthy donors (n=5), healthy smokers (n=3), rheumatoid arthritis (n=3) and breast cancer (n=2). Pooled libraries were constructed for each group and ChIPseq was carried out (Illumina). For comparative RNAseq analysis, activated CD4 T cells were incubated with or without survivin inhibitor (YM155) for 24h. State-of-the-art bioinformatics pipelines were applied for NGS data and the survivin-binding peaks were used for comparison with genes, chromatin state annotation and functional gene- and regulatory regions-based functional analysis. Co-localization of peaks in the whole genome and in vicinity of the differentially expressed genes (DEG) was done using ReMap integrated ChIPseq datasets for all human cells and tissues.Results:We identified 13 thousands non-overlapping survivin ChIP-peaks (>3000 peaks were present in at least 3 samples). Survivin-bound regions were enriched near the genes and promoters (p=e-30 and p=e-8), which implied that survivin role in transcription could be mediated by known transcription factors. Thus, we analyzed survivin peaks vs binding regions of 1135 transcription regulators (TR) available in ReMap.Potential partner proteins of survivin were selected based on the enrichment of the overlapping peaks in the whole genome and in CD4-active regulatory areas. Both, strict overlaps and location within 10 and 100kb survivin peak vicinity were analyzed. This approach allowed us to select >150 TRs enriched in all tests. The enriched TRs were involved in immunity and RA-relevant pathways including cytokine response and production, JAK-STAT signaling, etc. Among the TRs co-localized with survivin were CHD8, MAX, EP300, BRD2, CTCF and RAD21, all responsible for chromatin architecture. Several TRs were massively enriched in the vicinity of DEGs after survivin depletion including MAX, AR, CTCF, MYC and IRF1. Search for TR binding motifs in survivin peaks supported over-representation of binding sites for IRFs (p=e-5) and several proteins of the bZIP-family (p=e-5).Conclusion:Analysis of the survivin bound DNA in CD4 cells demonstrated the nonrandom distribution with specific enrichment within the regulatory elements of the genes and co-localizeation with protein partners to regulate their transcription.Disclosure of Interests:None declared

28

Bobev,S.G., O.I.Taphradjiiski, J.Hammond, and A.M.Vaira. "First Report of Freesia sneak virus Associated with Foliar Necrosis of Freesia refracta in Bulgaria." Plant Disease 97, no.11 (November 2013): 1514. http://dx.doi.org/10.1094/pdis-01-13-0046-pdn.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

In the early spring of 2011 and 2012, severe necrotic leaf symptoms were observed on freesia (Freesia refracta, family Iridaceae) in several greenhouses around Plovdiv (south central Bulgaria). The disease spread and symptom severity in several cultivars (Medeo, Calvados, and Pink Fountain) led to nearly complete production failure for some growers. Initial symptoms consisted of scattered pale, chlorotic, interveinal lesions that coalesced. Later, irregular brown to black necrotic blotches partially covered the leaves. Flower break was also observed. Diseased plants were collected in late April 2012 from one of the surveyed greenhouses, where >90% of Medeo (white-flowered) and 35 to 40% of Pink Fountain (pink) plants were symptomatic. Total RNA was extracted from three pooled samples of ~10 plants each and analyzed for Freesia sneak virus (3) (FreSV, Ophiovirus, Ophioviridae) infection by RT-PCR. A generic Ophiovirus RT-PCR (4) yielded the diagnostic 136-bp product, while primers FOV1 (TGCTCGAATAGCCGGAACTGAA) and FOV2 (TGCTTCCAGGTGTAAGATGGCA), designed from the Italian FreSV coat protein gene (RNA3; GenBank DQ885455), specifically amplified a 466 bp fragment. This FreSV-specific fragment was amplified from all samples, pooled, purified, and subjected to direct sequencing using the same primers. The deduced amino acid sequence had 99.8% identity to that of DQ885455, confirming FreSV infection in the symptomatic Bulgarian freesias. FreSV RNA3 (about 1.5 kbp) was also detected by northern blotting using a specific Digoxigenin-DNA probe (PCR-DIG Probe Synthesis Kit, Roche) amplified with primers FOV1/2. Due to severe symptoms present on freesias, a mixed infection was suspected. Several other viruses have been reported to infect cultivated freesia (1), so diagnostic primers for Cucumber mosaic virus (CMV, Cucumovirus, Bromoviridae), Tobacco rattle virus (TRV, Tobravirus, Virgaviridae), and Potyvirus genus (4) were used in RT-PCR assays with random-primed cDNA from infected freesias as the template. No CMV or TRV PCR products were detected; a generic potyvirus PCR product was identified as Freesia mosaic virus (FreMV, Potyvirus, Potyviridae) by sequencing of five independent clones. Severe leaf necrosis syndrome was described in freesia in The Netherlands before 1970, as well as in England and Germany; FreSV is a putative agent of freesia leaf necrosis, being reported in strong association with the disease in Italy, The Netherlands, the United States, and New Zealand, and also infects Lachenalia hyb. (Hyacinthaceae) (2,3,4). However, additional unidentified synergistic viral agents cannot be ruled out and must be identified to aid control of soilborne severe leaf necrosis syndrome. The vector of FreSV, Olpidium brassicae, may persist in soil for years (3). To our knowledge, this is the first report of FreSV on F. refracta in Bulgaria; identifying the disease and vector may allow growers to implement preventive control measures to reduce economic damage. References: (1) A. A. Brunt. In: Virus and Virus-Like Diseases of Flower Crops, pp. 274-280, Wiley, 1995. (2) M. N. Pearson et al. Austr. Plant Path. 38:305, 2009. (3) A. M. Vaira and R. G Milne. In: Encyclopedia of Virology, III ed., vol. 3, pp. 447-454, Elsevier, 2008. (4) A. M. Vaira et al. Plant Dis. 93:965, 2009.

29

Adriansen, Inge. "Grundtvigs bidrag til udvikling af danske nationale symboler." Grundtvig-Studier 57, no.1 (January1, 2006): 67–98. http://dx.doi.org/10.7146/grs.v57i1.16493.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Grundtvigs bidrag til udviklingen a f danske nationale symboler[Grundtvig ’s contribution to the development of Danish national symbols]By Inge AdriansenBroadly speaking, all Danish national symbols, both official and unofficial, are to be found in Grundtvig’s authorship. However, it is difficult to specify in what way and to what degree Grundtvig inspired the dissemination of the various symbols. The most important routes of dissemination were through Den Danske Salmebog [The Danish Hymnal] and Folkehøjskolens Sangbog [The Folk-highschool Songbookl. since the corrmosition of songs weighs heaviest in Grundtvig’s literary production. This is owing to his strong belief in the significance of song in educating the people, and to his talent for bringing to life the message of song in oral form. Since both the Hymnal and the Highschool Songbook continue to be published in revised editions, they have contributed to securing Grundtvig’s significance.Grundtvig’s hymns have often been perceived as the expression of something very Danish. Therefore he was almost entirely excluded from the first hymnal produced for the Danish-speaking congregations in the Duchy of Schleswig after its incorporation into Prussia in 1867. Some of Grundtvig’s hymns were characterised by Bishop Theodor Kaftan of Schleswig-Holstein as politically dubious and having Danish national colouring.After North Slesvig’s reunification with Denmark in 1920, Grundtvig’s hymn Den signede Dag [The blessed day] gained a special status. It was sung both at the meetings in January and February before the plebiscite and at the reunification festivities over the spring and summer. When, after the summer vacation, the schools reopened under Danish leadership, Den signede Dag was everywhere sung as the first moming-hymn. The children of Slesvig were in no doubt that Grundtvig was referring to Denmark in the final verse, which begins: “Nu rejser vi til vort Fadreland” [Now journey we to our fatherland]. In Grundtvigian homes in Slesvig the hymn was often sung at family festivities, and here it was that the tradition developed of standing up during the final verse - out of respect for the homecoming to fatherland and nation.The most significant contribution to the history of folk-education in Denmark is Grundtvig’s unitary view over hymn, historical ballad, and songs of fatherland and of folk-life. This achieves its expression in the Highschool Songbook which was first published in 1894 and has ever since helped set the norms for other Danish songbooks. The latest edition of the Highschool Songbook (from 1989) is the seventeenth, and here there are 119 songs by Grundtvig. This is 21% of the songbook’s 572 songs, and it shows that Grundtvig’s image-world continues to put its stamp upon representations of Danishness. This 17th edition was printed in over 500,000 copies, and thereby the Highschool Songbook became the Danish songbook published in the largest impression.Grundtvig has been the most significant generator of historical consciousness in Denmark, but it is a problem that only a small part of his enormous authorship and complex world of ideas is usually presented to us. At certain periods of his life Grundtvig was what many today would perceive as nationalistic. But it should be emphasised that he always stressed that Danishness has an historical and a geographical delimitation. Unfortunately there is little space within national symbolism for such complexity, and his metaphorical language was so multivalent that it has not been suited to being transposed into easily grasped symbols.Even so, this obscure metaphorical language has had a decisive significance in the development of Danish national symbolism. This is attributable in particular to the fact that Grundtvig managed to create that special interweaving of Christian, national and social identities which many Danes experience as being a matter of course and more or less of natural origin, something which has been here since the dawn of time.[Editors' note: Such terms as folkeopdragelse and folkeliv, here rendered as ‘folk-education’ and ‘folk-life’, confront Gr's translators with a special difficulty. The element folk- has little to do with the English term ‘folk-’, as in ‘folk-song’ and ‘folk-art’ with its implication of rustic or peasant provenance. Nor can it always be satisfactorily translated as ‘national’ or ‘popular’ though these can be aspects of its meaning. It essentially relates, in Grundtvigcontexts, to Gr's concept of folkelighed [‘folkliness’]: a form of social cohesion achieved by way of thinking and of conducting one's life in an enlightened and benevolent awareness of the mutual obligations and shared commitments and aspirations of a people or community identifiable by such cultural markers as a common history and a common language. In principle an inclusive concept, it nevertheless always had a potential to become exclusive in practice.]

30

Sun, Yaping, Kay Oravecz-Wilson, Thomas Saunders, Ying Wang, Tomomi Toubai, Nathan Mathewson, Chen Liu, et al. "Atypical E2F Dependent Dysregulation Of Cell Cycling By Microrna-142 Regulates T-Cell Responses and Experimental Graft-Versus-Host Disease." Blood 122, no.21 (November15, 2013): 136. http://dx.doi.org/10.1182/blood.v122.21.136.136.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract Noncoding microRNAs (miRs) have recently been linked to immune system function. We investigated the role of miR-142, a hematopoietic specific miR, in regulating T cell responses. To understand its specific function in T cell immunity we utilized hom*ologous recombination technology and generated mutant mice bearing a targeted deletion of the miR-142 gene on the B6 background. The hom*ozygous miR-142 knockout (KO) animals were viable, fertile and showed no apparent developmental anomalies. Thymic analyses of the miR142-/- animals demonstrated no significant differences when compared with WT littermate controls in total thymocytes, early thymic progenitors, DP and DN cells. Bone marrow studies demonstrated similar numbers of LSK+ HSCs while analyses of secondary lymphoid organs (spleen and popliteal lymph nodes) demonstrated similar absolute numbers of naïve T cells (CD44low62L+), memory like T cells (CD44hi62L+CCR7- and CD44hi62L-CCR7- cells), CD4+25+Foxp3+ cells, CD69+VLA4+CD3+ cells and weekly peripheral blood examination demonstrated similar lymphocyte counts as the WT littermates. Functional studies, however, demonstrated that when compared with WT T-cells, the KO T-cells showed significantly slower rate of proliferation by CFSE analyses upon stimulation anti-CD3+ and 28+ antibodies (P<0.003). They showed lower IL-2, IFNγ and IL-17 but greater amount of IL-6 production (P<0.001) and demonstrated greater apoptosis (P<0.02). Cell cycling analyses with flow cytometry demonstrated that a significantly greater percent of the miR142-/- T-cells were in the S and G2 phase (P<0.01) when compared with WT T-cells suggesting altered cell cycling. Similar reduction in proliferation, cytokine secretion by the miR142-/- T-cells was also observed upon in vitro stimulation with allogeneic BALB/c DCs. To determine the in vivo relevance of miR142 deficiency in T cells, we next utilized MHC mismatched B6àBALB/c model of allogeneic BMT. BALB/c animals were lethally irradiated (9Gy) and transplanted on day 0 with 5x106 BM from WT B6 animals along with 2x106 splenic CD90+T cells from the WT or miR142-/- donors. The allogeneic animals that received KO T-cells showed significantly less severe clinical, histopathological GVHD (GI tract on days 7 and 21) and mortality (P<0.02). Analyses of donor T cells on day 7 post-BMT demonstrated reduced expansion and IFNγ secretion (P<0.04) but showed no significant differences in the ratio of Treg:conventional T-cells between the WT and KO T-cell allogeneic recipients. To further confirm the specific role of miR142 deficiency, we next treated the WT animals with miR-142 anatgomir (days 1, 3 and 7) and found that it significantly reduced GVHD mortality (P<0.003). The KO T-cells also reduced GVHD mortality in a MHC matched minor mismatched B6→C3H.sw BMT model demonstrating strain independent effects. To further determine the miR142 specific molecular mechanisms we performed extensive bioinformatic analyses. In light of a defect in T cell cycling in miR142-/- T-cells, we focused on the putative miR142 targets that are known to regulate cell cycling. Two of the three bioinformatic programs suggested the following known regulators of cell cycling, EGR2, DAG, all eight E2F transcription factor family (the typical E2F1-6 and atypical E2F7-8) members as putative targets. We next performed DNA microarray analyses to determine differential gene expression patterns in miR142-/- and WT T cells, which demonstrated an increase in the expression (>15x) of only the atypical E2Fs, namely E2F7 and E2F8, but not in any of the other above predicted cell cycle regulating molecules. The increase in the expression of the atypical E2Fs in the miR142-/- T-cells was next confirmed by PCR analyses at baseline (unstimulated) and also sequentially at 6, 12, 24 and 48 hours following in vitro stimulation. Knockdown of E2F7 and E2F8 in miR142-/- T cells with sh-RNA rescued their proliferative responses and corrected the cell cycling defects to the levels comparable to WT T-cells, thus demonstrating that the atypical E2F7 and 8 are critical for miR-142 mediated regulation of T cells. Thus our data show (a) generation of a novel miR142 knockout mouse (b) demonstrate that miR142 regulates T cell responses in vitro and in vivo by targeting atypical E2Fs and (c) suggest that targeting miR142 in vivo with its antagomir might be a novel therapeutic strategy for regulating GVHD. Disclosures: No relevant conflicts of interest to declare.

31

Wang, Huishan, Lisheng Liao, Shaohua Chen, and Lian-Hui Zhang. "A Quorum Quenching Bacterial Isolate Contains Multiple Substrate-Inducible Genes Conferring Degradation of Diffusible Signal Factor." Applied and Environmental Microbiology 86, no.7 (January24, 2020). http://dx.doi.org/10.1128/aem.02930-19.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

ABSTRACT Quorum quenching, which disrupts quorum sensing (QS) by either degradation of QS signals or interference of signal generation or perception, is a promising strategy for the prevention and control of QS-mediated bacterial infections. Diffusible signal factor (DSF) is widely conserved in many Gram-negative bacterial pathogens. In this study, we developed an efficient method for screening of highly active DSF degradation microorganisms. Among them, Pseudomonas sp. strain HS-18 showed a superior DSF degradation activity. Bioinformatics and genetic analyses showed that at least 4 genes, designated digA to digD, encoding fatty acyl coenzyme A ligase hom*ologues, are responsible for DSF signal degradation. Interestingly, all 4 dig genes were induced by exogenous DSF, with digA being the most significantly induced. Expression of the dig genes in Xanthom*onas campestris pv. campestris markedly reduced the accumulation of endogenous DSF, decreased production of virulence factors, and attenuated bacterial virulence on host plants. Similarly, application of strain HS-18 as a biocontrol agent could substantially reduce the disease severity caused by X. campestris pv. campestris. These results unveil the molecular basis of a highly efficient DSF degradation bacterial isolate and present useful genes and biocontrol agents for control of the infectious diseases caused by DSF-dependent bacterial pathogens. IMPORTANCE Diffusible signal factor (DSF) represents a family of widely conserved quorum sensing signals involved in the regulation of virulence factor production in many Gram-negative bacterial pathogens. In this study, we developed a novel and efficient method for screening highly active DSF degradation microorganisms. With this method, we identified a bacterial isolate, Pseudomonas sp. strain HS-18, with a superb DSF degradation activity. We further found that strain HS-18 contains 4 genes responsible for DSF signal degradation, and significantly, these were induced by exogenous DSF molecules. These findings unveil the molecular basis of a highly efficient DSF degradation bacterial isolate and present useful methods, genes, and agents for control of the infectious diseases caused by DSF-dependent bacterial pathogens.

32

Ademhan Tural, Dilber, Seyit Ahmet Ucakturk, Hakan Guvenir, Can Naci Kocabas, and Emine Dibek Misirlioglu. "Evaluation of Allergic Disease Prevalence and Related Risk Factors in Children with Autoimmune Thyroiditis." International Archives of Allergy and Immunology, April19, 2021, 1–9. http://dx.doi.org/10.1159/000515499.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

<b><i>Background:</i></b> Allergic and autoimmune diseases are caused by an impaired immunological response resulting from different types of T-helper (Th) cells. Since the Th cell production is in a certain balance, an inverse relationship between the 2 disease groups may exist. In this study, we aimed to investigate the frequency of allergic diseases in children with autoimmune thyroiditis (AT). <b><i>Methods:</i></b> Symptoms of allergic diseases were investigated by the (International Study of Asthma and Allergies in Childhood) ISAAC questionnaire. The questionnaire was administered to a group of 300 children with AT and a control group of 300 children with no known autoimmune disease. The risk factors for allergic diseases and sociodemographic characteristics were investigated. A multivariable logistic regression analysis was performed with the risk factors of allergic diseases. <b><i>Results:</i></b> Asthma, wheezing during the last year, wheezing with exercise, disease-free night cough, and night cough were significantly less common in patients with AT. Allergic rhinitis symptoms, except physician-diagnosed allergic rhinitis, are found significantly less frequently in patients with AT. It was found that the presence of AT and an increase in the number of children in the family reduce the risk of allergic diseases; cat-dog contact before 1 year of age and the presence of asthma, eczema, or allergic rhinitis in the mother increase the risk of allergic diseases. <b><i>Conclusions:</i></b> Asthma and allergic rhinitis symptoms were significantly less common in children with AT. AT reduces the risk of allergic diseases.

33

Brien, Donna Lee, Leonie Rutherford, and Rosemary Williamson. "Hearth and Hotmail." M/C Journal 10, no.4 (August1, 2007). http://dx.doi.org/10.5204/mcj.2696.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Introduction It has frequently been noted that ICTs and social networking applications have blurred the once-clear boundary between work, leisure and entertainment, just as they have collapsed the distinction between public and private space. While each individual has a sense of what “home” means, both in terms of personal experience and more conceptually, the following three examples of online interaction (based on participants’ interest, or involvement, in activities traditionally associated with the home: pet care, craft and cooking) suggest that the utilisation of online communication technologies can lead to refined and extended definitions of what “home” is. These examples show how online communication can assist in meeting the basic human needs for love, companionship, shelter and food – needs traditionally supplied by the home environment. They also provide individuals with a considerably expanded range of opportunities for personal expression and emotional connection, as well as creative and commercial production, than that provided by the purely physical (and, no doubt, sometimes isolated and isolating) domestic environment. In this way, these case studies demonstrate the interplay and melding of physical and virtual “home” as domestic practices leach from the most private spaces of the physical home into the public space of the Internet (for discussion, see Gorman-Murray, Moss, and Rose). At the same time, online interaction can assert an influence on activity within the physical space of the home, through the sharing of advice about, and modeling of, domestic practices and processes. A Dog’s (Virtual) Life The first case study primarily explores the role of online communities in the formation and expression of affective values and personal identity – as traditionally happens in the domestic environment. Garber described the 1990s as “the decade of the dog” (20), citing a spate of “new anthropomorphic” (22) dog books, Internet “dog chat” sites, remakes of popular classics such as Lassie Come Home, dog friendly urban amenities, and the meteoric rise of services for pampered pets (28-9). Loving pets has become a lifestyle and culture, witnessed and commodified in Pet Superstores as well as in dog collectables and antiques boutiques, and in publications like The Bark (“the New Yorker of Dog Magazines”) and Clean Run, the international agility magazine, Website, online book store and information gateway for agility products and services. Available online resources for dog lovers have similarly increased rapidly during the decade since Garber’s book was published, with the virtual world now catering for serious hobby trainers, exhibitors and professionals as well as the home-based pet lover. At a recent survey, Yahoo Groups – a personal communication portal that facilitates social networking, in this case enabling users to set up electronic mailing lists and Internet forums – boasted just over 9,600 groups servicing dog fanciers and enthusiasts. The list Dogtalk is now an announcement only mailing list, but was a vigorous discussion forum until mid-2006. Members of Dogtalk were Australian-based “clicker-trainers”, serious hobbyist dog trainers, many of whom operated micro-businesses providing dog training or other pet-related services. They shared an online community, but could also engage in “flesh-meets” at seminars, conferences and competitive dog sport meets. An author of this paper (Rutherford) joined this group two years ago because of her interest in clicker training. Clicker training is based on an application of animal learning theory, particularly psychologist E. F. Skinner’s operant conditioning, so called because of the trademark use of a distinctive “click” sound to mark a desired behaviour that is then rewarded. Clicker trainers tend to dismiss anthropomorphic pack theory that positions the human animal as fundamentally opposed to non-human animals and, thus, foster a partnership (rather than a dominator) mode of social and learning relationships. Partnership and nurturance are common themes within the clicker community (as well as in more traditional “home” locations); as is recognising and valuing the specific otherness of other species. Typically, members regard their pets as affective equals or near-equals to the human animals that are recognised members of their kinship networks. A significant function of the episodic biographical narratives and responses posted to this list was thus to affirm and legitimate this intra-specific kinship as part of normative social relationship – a perspective that is not usually validated in the general population. One of the more interesting nexus that evolved within Dogtalk links the narrativisation of the pet in the domestic sphere with the pictorial genre of the family album. Emergent technologies, such as digital cameras together with Web-based image manipulation software and hosting (as provided by portals like Photobucket and Flickr ) democratise high quality image creation and facilitate the sharing of these images. Increasingly, the Dogtalk list linked to images uploaded to free online galleries, discussed digital image composition and aesthetics, and shared technical information about cameras and online image distribution. Much of this cultural production and circulation was concerned with digitally inscribing particular relationships with individual animals into cultural memory: a form of family group biography (for a discussion of the family photograph as a display of extended domestic space, see Rose). The other major non-training thread of the community involves the sharing and witnessing of the trauma suffered due to the illness and loss of pets. While mourning for human family members is supported in the off-line world – with social infrastructure, such as compassionate leave and/or bereavement counselling, part of professional entitlements – public mourning for pets is not similarly supported. Yet, both cultural studies (in its emphasis on cultural memory) and trauma theory have highlighted the importance of social witnessing, whereby traumatic memories must be narratively integrated into memory and legitimised by the presence of a witness in order to loosen their debilitating hold (Felman and Laub 57). Postings on the progress of a beloved animal’s illness or other misfortune and death were thus witnessed and affirmed by other Dogtalk list members – the sick or deceased pet becoming, in the process, a feature of community memory, not simply an individual loss. In terms of such biographical narratives, memory and history are not identical: “Any memories capable of being formed, retained or articulated by an individual are always a function of socially constituted forms, narratives and relations … Memory is always subject to active social manipulation and revision” (Halbwachs qtd. in Crewe 75). In this way, emergent technologies and social software provide sites, akin to that of physical homes, for family members to process individual memories into cultural memory. Dogzonline, the Australian Gateway site for purebred dog enthusiasts, has a forum entitled “Rainbow Bridge” devoted to textual and pictorial memorialisation of deceased pet dogs. Dogster hosts the For the Love of Dogs Weblog, in which images and tributes can be posted, and also provides links to other dog oriented Weblogs and Websites. An interesting combination of both therapeutic narrative and the commodification of affect is found in Lightning Strike Pet Loss Support which, while a memorial and support site, also provides links to the emerging profession of pet bereavement counselling and to suppliers of monuments and tributary urns for home or other use. loobylu and Narratives of Everyday Life The second case study focuses on online interactions between craft enthusiasts who are committed to the production of distinctive objects to decorate and provide comfort in the home, often using traditional methods. In the case of some popular craft Weblogs, online conversations about craft are interspersed with, or become secondary to, the narration of details of family life, the exploration of important life events or the recording of personal histories. As in the previous examples, the offering of advice and encouragement, and expressions of empathy and support, often characterise these interactions. The loobylu Weblog was launched in 2001 by illustrator and domestic crafts enthusiast Claire Robertson. Robertson is a toy maker and illustrator based in Melbourne, Australia, whose clients have included prominent publishing houses, magazines and the New York Public Library (Robertson “Recent Client List” online). She has achieved a measure of public recognition: her loobylu Weblog has won awards and been favourably commented upon in the Australian press (see Robertson “Press for loobylu” online). In 2005, an article in The Age placed Robertson in the context of a contemporary “craft revolution”, reporting her view that this “revolution” is in “reaction to mass consumerism” (Atkinson online). The hand-made craft objects featured in Robertson’s Weblogs certainly do suggest engagement with labour-intensive pursuits and the construction of unique objects that reject processes of mass production and consumption. In this context, loobylu is a vehicle for the display and promotion of Robertson’s work as an illustrator and as a craft practitioner. While skills-based, it also, however, promotes a family-centred lifestyle; it advocates the construction by hand of objects designed to enhance the appearance of the family home and the comfort of its inhabitants. Its specific subject matter extends to related aspects of home and family as, in addition to instructions, ideas and patterns for craft, the Weblog features information on commercially available products for home and family, recipes, child rearing advice and links to 27 other craft and other sites (including Nigella Lawson’s, discussed below). The primary member of its target community is clearly the traditional homemaker – the mother – as well as those who may aspire to this role. Robertson does not have the “celebrity” status of Lawson and Jamie Oliver (discussed below), nor has she achieved their market saturation. Indeed, Robertson’s online presence suggests a modest level of engagement that is placed firmly behind other commitments: in February 2007, she announced an indefinite suspension of her blog postings so that she could spend more time with her family (Robertson loobylu 17 February 2007). Yet, like Lawson and Oliver, Robertson has exploited forms of domestic competence traditionally associated with women and the home, and the non-traditional medium of the Internet has been central to her endeavours. The content of the loobylu blog is, unsurprisingly, embedded in, or an accessory to, a unifying running commentary on Robertson’s domestic life as a parent. Miles, who has described Weblogs as “distributed documentaries of the everyday” (66) sums this up neatly: “the weblogs’ governing discursive quality is the manner in which it is embodied within the life world of its author” (67). Landmark family events are narrated on loobylu and some attract deluges of responses: the 19 June 2006 posting announcing the birth of Robertson’s daughter Lily, for example, drew 478 responses; five days later, one describing the difficult circ*mstances of her birth drew 232 comments. All of these comments are pithy, with many being simple empathetic expressions or brief autobiographically based commentaries on these events. Robertson’s news of her temporary retirement from her blog elicited 176 comments that both supported her decision and also expressed a sense of loss. Frequent exclamation marks attest visually to the emotional intensity of the responses. By narrating aspects of major life events to which the target audience can relate, the postings represent a form of affective mass production and consumption: they are triggers for a collective outpouring of largely hom*ogeneous emotional reaction (joy, in the case of Lily’s birth). As collections of texts, they can be read as auto/biographic records, arranged thematically, that operate at both the individual and the community levels. Readers of the family narratives and the affirming responses to them engage in a form of mass affirmation and consumerism of domestic experience that is easy, immediate, attractive and free of charge. These personal discourses blend fluidly with those of a commercial nature. Some three weeks after loobylu announced the birth of her daughter, Robertson shared on her Weblog news of her mastitis, Lily’s first smile and the family’s favourite television programs at the time, information that many of us would consider to be quite private details of family life. Three days later, she posted a photograph of a sleeping baby with a caption that skilfully (and negatively) links it to her daughter: “Firstly – I should mention that this is not a photo of Lily”. The accompanying text points out that it is a photo of a baby with the “Zaky Infant Sleeping Pillow” and provides a link to the online pregnancystore.com, from which it can be purchased. A quotation from the manufacturer describing the merits of the pillow follows. Robertson then makes a light-hearted comment on her experiences of baby-induced sleep-deprivation, and the possible consequences of possessing the pillow. Comments from readers also similarly alternate between the personal (sharing of experiences) to the commercial (comments on the product itself). One offshoot of loobylu suggests that the original community grew to an extent that it could support specialised groups within its boundaries. A Month of Softies began in November 2004, describing itself as “a group craft project which takes place every month” and an activity that “might give you a sense of community and kinship with other similar minded crafty types across the Internet and around the world” (Robertson A Month of Softies online). Robertson gave each month a particular theme, and readers were invited to upload a photograph of a craft object they had made that fitted the theme, with a caption. These were then included in the site’s gallery, in the order in which they were received. Added to the majority of captions was also a link to the site (often a business) of the creator of the object; another linking of the personal and the commercial in the home-based “cottage industry” sense. From July 2005, A Month of Softies operated through a Flickr site. Participants continued to submit photos of their craft objects (with captions), but also had access to a group photograph pool and public discussion board. This extension simulates (albeit in an entirely visual way) the often home-based physical meetings of craft enthusiasts that in contemporary Australia take the form of knitting, quilting, weaving or other groups. Chatting with, and about, Celebrity Chefs The previous studies have shown how the Internet has broken down many barriers between what could be understood as the separate spheres of emotional (that is, home-based private) and commercial (public) life. The online environment similarly enables the formation and development of fan communities by facilitating communication between those fans and, sometimes, between fans and the objects of their admiration. The term “fan” is used here in the broadest sense, referring to “a person with enduring involvement with some subject or object, often a celebrity, a sport, TV show, etc.” (Thorne and Bruner 52) rather than focusing on the more obsessive and, indeed, more “fanatical” aspects of such involvement, behaviour which is, increasingly understood as a subculture of more variously constituted fandoms (Jenson 9-29). Our specific interest in fandom in relation to this discussion is how, while marketers and consumer behaviourists study online fan communities for clues on how to more successfully market consumer goods and services to these groups (see, for example, Kozinets, “I Want to Believe” 470-5; “Utopian Enterprise” 67-88; Algesheimer et al. 19-34), fans regularly subvert the efforts of those urging consumer consumption to utilise even the most profit-driven Websites for non-commercial home-based and personal activities. While it is obvious that celebrities use the media to promote themselves, a number of contemporary celebrity chefs employ the media to construct and market widely recognisable personas based on their own, often domestically based, life stories. As examples, Jamie Oliver and Nigella Lawson’s printed books and mass periodical articles, television series and other performances across a range of media continuously draw on, elaborate upon, and ultimately construct their own lives as the major theme of these works. In this, these – as many other – celebrity chefs draw upon this revelation of their private lives to lend authenticity to their cooking, to the point where their work (whether cookbook, television show, advertisem*nt or live chat room session with their fans) could be described as “memoir-illustrated-with-recipes” (Brien and Williamson). This generic tendency influences these celebrities’ communities, to the point where a number of Websites devoted to marketing celebrity chefs as product brands also enable their fans to share their own life stories with large readerships. Oliver and Lawson’s official Websites confirm the privileging of autobiographical and biographical information, but vary in tone and approach. Each is, for instance, deliberately gendered (see Hollows’ articles for a rich exploration of gender, Oliver and Lawson). Oliver’s hip, boyish, friendly, almost frantic site includes the what are purported-to-be self-revelatory “Diary” and “About me” sections, a selection of captioned photographs of the chef, his family, friends, co-workers and sponsors, and his Weblog as well as footage streamed “live from Jamie’s phone”. This self-revelation – which includes significant details about Oliver’s childhood and his domestic life with his “lovely girls, Jools [wife Juliette Norton], Poppy and Daisy” – completely blurs the line between private life and the “Jamie Oliver” brand. While such revelation has been normalised in contemporary culture, this practice stands in great contrast to that of renowned chefs and food writers such as Elizabeth David, Julia Child, James Beard and Margaret Fulton, whose work across various media has largely concentrated on food, cooking and writing about cooking. The difference here is because Oliver’s (supposedly private) life is the brand, used to sell “Jamie Oliver restaurant owner and chef”, “Jamie Oliver cookbook author and TV star”, “Jamie Oliver advertising spokesperson for Sainsbury’s supermarket” (from which he earns an estimated £1.2 million annually) (Meller online) and “Jamie Oliver social activist” (made MBE in 2003 after his first Fifteen restaurant initiative, Oliver was named “Most inspiring political figure” in the 2006 Channel 4 Political Awards for his intervention into the provision of nutritious British school lunches) (see biographies by Hildred and Ewbank, and Smith). Lawson’s site has a more refined, feminine appearance and layout and is more mature in presentation and tone, featuring updates on her (private and public) “News” and forthcoming public appearances, a glamorous selection of photographs of herself from the past 20 years, and a series of print and audio interviews. Although Lawson’s children have featured in some of her television programs and her personal misfortunes are well known and regularly commented upon by both herself and journalists (her mother, sister and husband died of cancer) discussions of these tragedies, and other widely known aspects of her private life such as her second marriage to advertising mogul Charles Saatchi, is not as overt as on Oliver’s site, and the user must delve to find it. The use of Lawson’s personal memoir, as sales tool, is thus both present and controlled. This is in keeping with Lawson’s professional experience prior to becoming the “domestic goddess” (Lawson 2000) as an Oxford graduated journalist on the Spectator and deputy literary editor of the Sunday Times. Both Lawson’s and Oliver’s Websites offer readers various ways to interact with them “personally”. Visitors to Oliver’s site can ask him questions and can access a frequently asked question area, while Lawson holds (once monthly, now irregularly) a question and answer forum. In contrast to this information about, and access to, Oliver and Lawson’s lives, neither of their Websites includes many recipes or other food and cooking focussed information – although there is detailed information profiling their significant number of bestselling cookbooks (Oliver has published 8 cookbooks since 1998, Lawson 5 since 1999), DVDs and videos of their television series and one-off programs, and their name branded product lines of domestic kitchenware (Oliver and Lawson) and foodstuffs (Oliver). Instruction on how to purchase these items is also featured. Both these sites, like Robertson’s, provide various online discussion fora, allowing members to comment upon these chefs’ lives and work, and also to connect with each other through posted texts and images. Oliver’s discussion forum section notes “this is the place for you all to chat to each other, exchange recipe ideas and maybe even help each other out with any problems you might have in the kitchen area”. Lawson’s front page listing states: “You will also find a moderated discussion forum, called Your Page, where our registered members can swap ideas and interact with each other”. The community participants around these celebrity chefs can be, as is the case with loobylu, divided into two groups. The first is “foodie (in Robertson’s case, craft) fans” who appear to largely engage with these Websites to gain, and to share, food, cooking and craft-related information. Such fans on Oliver and Lawson’s discussion lists most frequently discuss these chefs’ television programs and books and the recipes presented therein. They test recipes at home and discuss the results achieved, any problems encountered and possible changes. They also post queries and share information about other recipes, ingredients, utensils, techniques, menus and a wide range of food and cookery-related matters. The second group consists of “celebrity fans” who are attracted to the chefs (as to Robertson as craft maker) as personalities. These fans seek and share biographical information about Oliver and Lawson, their activities and their families. These two areas of fan interest (food/cooking/craft and the personal) are not necessarily or always separated, and individuals can be active members of both types of fandoms. Less foodie-orientated users, however (like users of Dogtalk and loobylu), also frequently post their own auto/biographical narratives to these lists. These narratives, albeit often fragmented, may begin with recipes and cooking queries or issues, but veer off into personal stories that possess only minimal or no relationship to culinary matters. These members also return to the boards to discuss their own revealed life stories with others who have commented on these narratives. Although research into this aspect is in its early stages, it appears that the amount of public personal revelation either encouraged, or allowed, is in direct proportion to the “open” friendliness of these sites. More thus are located in Oliver’s and less in Lawson’s, and – as a kind of “control” in this case study, but not otherwise discussed – none in that of Australian chef Neil Perry, whose coolly sophisticated Website perfectly complements Perry’s professional persona as the epitome of the refined, sophisticated and, importantly in this case, unapproachable, high-end restaurant chef. Moreover, non-cuisine related postings are made despite clear directions to the contrary – Lawson’s site stating: “We ask that postings are restricted to topics relating to food, cooking, the kitchen and, of course, Nigella!” and Oliver making the plea, noted above, for participants to keep their discussions “in the kitchen area”. Of course, all such contemporary celebrity chefs are supported by teams of media specialists who selectively construct the lives that these celebrities share with the public and the postings about others’ lives that are allowed to remain on their discussion lists. The intersection of the findings reported above with the earlier case studies suggests, however, that even these most commercially-oriented sites can provide a fruitful data regarding their function as home-like spaces where domestic practices and processes can be refined, and emotional relationships formed and fostered. In Summary As convergence results in what Turow and Kavanaugh call “the wired homestead”, our case studies show that physically home-based domestic interests and practices – what could be called “home truths” – are also contributing to a refiguration of the private/public interplay of domestic activities through online dialogue. In the case of Dogtalk, domestic space is reconstituted through virtual spaces to include new definitions of family and memory. In the case of loobylu, the virtual interaction facilitates a development of craft-based domestic practices within the physical space of the home, thus transforming domestic routines. Jamie Oliver’s and Nigella Lawson’s sites facilitate development of both skills and gendered identities by means of a bi-directional nexus between domestic practices, sites of home labour/identity production and public media spaces. As participants modify and redefine these online communities to best suit their own needs and desires, even if this is contrary to the stated purposes for which the community was instituted, online communities can be seen to be domesticated, but, equally, these modifications demonstrate that the activities and relationships that have traditionally defined the home are not limited to the physical space of the house. While virtual communities are “passage points for collections of common beliefs and practices that united people who were physically separated” (Stone qtd in Jones 19), these interactions can lead to shared beliefs, for example, through advice about pet-keeping, craft and cooking, that can significantly modify practices and routines in the physical home. Acknowledgments An earlier version of this paper was presented at the Association of Internet Researchers’ International Conference, Brisbane, 27-30 September 2006. The authors would like to thank the referees of this article for their comments and input. Any errors are, of course, our own. References Algesheimer, R., U. Dholake, and A. Herrmann. “The Social Influence of Brand Community: Evidence from European Car Clubs”. Journal of Marketing 69 (2005): 19-34. Atkinson, Frances. “A New World of Craft”. The Age (11 July 2005). 28 May 2007 http://www.theage.com.au/articles/2005/07/10/1120934123262.html>. Brien, Donna Lee, and Rosemary Williamson. “‘Angels of the Home’ in Cyberspace: New Technologies and Biographies of Domestic Production”. Paper. Biography and New Technologies conference. Humanities Research Centre, Australian National University, Canberra, ACT. 12-14 Sep. 2006. Crewe, Jonathan. “Recalling Adamastor: Literature as Cultural Memory in ‘White’ South Africa”. In Acts of Memory: Cultural Recall in the Present, eds. Mieke Bal, Jonathan Crewe, and Leo Spitzer. Hanover, NH: Dartmouth College, 1999. 75-86. Felman, Shoshana, and Dori Laub. Testimony: Crises of Witnessing in Literature, Psychoanalysis, and History. New York: Routledge, 1992. Garber, Marjorie. Dog Love. New York: Touchstone/Simon and Schuster, 1996. Gorman-Murray, Andrew. “Homeboys: Uses of Home by Gay Australian Men”. Social and Cultural Geography 7.1 (2006): 53-69. Halbwachs, Maurice. On Collective Memory. Trans. Lewis A. Closer. Chicago: U of Chicago P, 1992. Hildred, Stafford, and Tim Ewbank. Jamie Oliver: The Biography. London: Blake, 2001. Hollows, Joanne. “Feeling like a Domestic Goddess: Post-Feminism and Cooking.” European Journal of Cultural Studies 6.2 (2003): 179-202. ———. “Oliver’s Twist: Leisure, Labour and Domestic Masculinity in The Naked Chef.” International Journal of Cultural Studies 6.2 (2003): 229-248. Jenson, J. “Fandom as Pathology: The Consequences of Characterization”. The Adoring Audience; Fan Culture and Popular Media. Ed. L. A. Lewis. New York, NY: Routledge, 1992. 9-29. Jones, Steven G., ed. Cybersociety, Computer-Mediated Communication and Community. Thousand Oaks, CA: Sage, 1995. Kozinets, R.V. “‘I Want to Believe’: A Netnography of the X’Philes’ Subculture of Consumption”. Advances in Consumer Research 34 (1997): 470-5. ———. “Utopian Enterprise: Articulating the Meanings of Star Trek’s Culture of Consumption.” Journal of Consumer Research 28 (2001): 67-88. Lawson, Nigella. How to Be a Domestic Goddess: Baking and the Art of Comfort Cooking. London: Chatto and Windus, 2000. Meller, Henry. “Jamie’s Tips Spark Asparagus Shortages”. Daily Mail (17 June 2005). 21 Aug. 2007 http://www.dailymail.co.uk/pages/live/articles/health/dietfitness.html? in_article_id=352584&in_page_id=1798>. Miles, Adrian. “Weblogs: Distributed Documentaries of the Everyday.” Metro 143: 66-70. Moss, Pamela. “Negotiating Space in Home Environments: Older Women Living with Arthritis.” Social Science and Medicine 45.1 (1997): 23-33. Robertson, Claire. Claire Robertson Illustration. 2000-2004. 28 May 2007 . Robertson, Claire. loobylu. 16 Feb. 2007. 28 May 2007 http://www.loobylu.com>. Robertson, Claire. “Press for loobylu.” Claire Robertson Illustration. 2000-2004. 28 May 2007 http://www.clairetown.com/press.html>. Robertson, Claire. A Month of Softies. 28 May 2007. 21 Aug. 2007 . Robertson, Claire. “Recent Client List”. Claire Robertson Illustration. 2000-2004. 28 May 2007 http://www.clairetown.com/clients.html>. Rose, Gillian. “Family Photographs and Domestic Spacings: A Case Study.” Transactions of the Institute of British Geographers NS 28.1 (2003): 5-18. Smith, Gilly. Jamie Oliver: Turning Up the Heat. Sydney: Macmillian, 2006. Thorne, Scott, and Gordon C. Bruner. “An Exploratory Investigation of the Characteristics of Consumer Fanaticism.” Qualitative Market Research: An International Journal 9.1 (2006): 51-72. Turow, Joseph, and Andrea Kavanaugh, eds. The Wired Homestead: An MIT Press Sourcebook on the Internet and the Family. Cambridge, MA: MIT Press, 2003. Citation reference for this article MLA Style Brien, Donna Lee, Leonie Rutherford, and Rosemary Williamson. "Hearth and Hotmail: The Domestic Sphere as Commodity and Community in Cyberspace." M/C Journal 10.4 (2007). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0708/10-brien.php>. APA Style Brien, D., L. Rutherford, and R. Williamson. (Aug. 2007) "Hearth and Hotmail: The Domestic Sphere as Commodity and Community in Cyberspace," M/C Journal, 10(4). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0708/10-brien.php>.

34

Eubanks,KevinP. "Becoming-Samurai." M/C Journal 10, no.2 (May1, 2007). http://dx.doi.org/10.5204/mcj.2643.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Samurai and Chinese martial arts themes inspire and permeate the uniquely philosophical lyrics and beats of Wu-Tang Clan, a New York-based hip-hop collective made popular in the mid-nineties with their debut album Enter the Wu-Tang: Return of the 36 Chambers. Original founder RZA (“Rizza”) scored his first full-length motion-picture soundtrack and made his feature film debut with Ghost Dog: The Way of the Samurai (Jim Jarmusch, 2000). Through a critical exploration of the film’s musical filter, it will be argued that RZA’s aesthetic vision effectively deterritorialises the figure of the samurai, according to which the samurai “change[s] in nature and connect[s] with other multiplicities” (Deleuze and Guattari, 9). The soundtrack consequently emancipates and redistributes the idea of the samurai from within the dynamic context of a fundamentally different aesthetic intensity, which the Wu-Tang has always hoped to communicate, that is to say, an aesthetics of adaptation or of what is called in hip-hop music more generally: an aesthetics of flow. At the center of Jarmusch’s film is a fundamental opposition between the sober asceticism and deeply coded lifestyle of Ghost Dog and the supple, revolutionary, itinerant hip-hop beats that flow behind it and beneath it, and which serve at once as philosophical foil and as alternate foundation to the film’s themes and message. Ghost Dog: The Way of the Samurai tells the story of Ghost Dog (Forest Whitaker), a deadly and flawlessly precise contract killer for a small-time contemporary New York organised crime family. He lives his life in a late 20th-century urban America according to the strict tenets of the 18th century text Hagakure, which relates the principles of the Japanese Bushido (literally, the “way of the warrior,” but more often defined and translated as the “code of the samurai”). Others have noted the way in which Ghost Dog not only fails as an adaptation of the samurai genre but thematises this very failure insofar as the film depicts a samurai’s unsuccessful struggle to adapt in a corrupt and fractured postmodern, post-industrial reality (Lanzagorta, par. 4, 9; Otomo, 35-8). If there is any hope at all for these adaptations (Ghost Dog is himself an example), it lies, according to some, in the singular, outmoded integrity of his nostalgia, which despite the abstract jouissance or satisfaction it makes available, is nevertheless blank and empty (Otomo, 36-7). Interestingly, in his groundbreaking book Spectacular Vernaculars, and with specific reference to hip-hop, Russell Potter suggests that where a Eurocentric postmodernism posits a lack of meaning and collapse of value and authority, a black postmodernism that is neither singular nor nostalgic is prepared to emerge (6-9). And as I will argue there are more concrete adaptive strategies at work in the film, strategies that point well beyond the film to popular culture more generally. These are anti-nostalgic strategies of possibility and escape that have everything to do with the way in which hip-hop as soundtrack enables Ghost Dog in his becoming-samurai, a process by which a deterritorialised subject and musical flow fuse to produce a hybrid adaptation and identity. But hip-hip not only makes possible such a becoming, it also constitutes a potentially liberating adaptation of the past and of otherness that infuses the film with a very different but still concrete jouissance. At the root of Ghost Dog is a conflict between what Deleuze and Guattari call state and nomad authority, between the code that prohibits adaptation and its willful betrayer. The state apparatus, according to Deleuze and Guattari, is the quintessential form of interiority. The state nourishes itself through the appropriation, the bringing into its interior, of all that over which it exerts its control, and especially over those nomadic elements that constantly threaten to escape (Deleuze and Guattari, 380-7). In Ghost Dog, the code or state-form functions throughout the film as an omnipresent source of centralisation, authorisation and organisation. It is attested to in the intensely stratified urban environment in which Ghost Dog lives, a complicated and forbidding network of streets, tracks, rails, alleys, cemeteries, tenement blocks, freeways, and shipping yards, all of which serve to hem Ghost Dog in. And as race is highlighted in the film, it, too, must be included among the many ways in which characters are always already contained. What encounters with racism in the film suggest is the operative presence of a plurality of racial and cultural codes; the strict segregation of races and cultures in the film and the animosity which binds them in opposition reflect a racial stratification that mirrors the stratified topography of the cityscape. Most important, perhaps, is the way in which Bushido itself functions, at least in part, as code, as well as the way in which the form of the historical samurai in legend and reality circ*mscribes not only Ghost Dog’s existence but the very possibility of the samurai and the samurai film as such. On the one hand, Bushido attests to the absolute of religion, or as Deleuze and Guattari describe it: “a center that repels the obscure … essentially a horizon that encompasses” and which forms a “bond”, “pact”, or “alliance” between subject/culture and the all-encompassing embrace of its deity: in this case, the state-form which sanctions samurai existence (382-3). On the other hand, but in the same vein, the advent of Bushido, and in particular the Hagakure text to which Ghost Dog turns for meaning and guidance, coincides historically with the emergence of the modern Japanese state, or put another way, with the eclipse of the very culture it sponsors. In fact, samurai history as a whole can be viewed to some extent as a process of historical containment by which the state-form gradually encompassed those nomadic warring elements at the heart of early samurai existence. This is the socio-historical context of Bushido, insofar as it represents the codification of the samurai subject and the stratification of samurai culture under the pressures of modernisation and the spread of global capitalism. It is a social and historical context marked by the power of a bourgeoning military, political and economic organisation, and by policies of restraint, centralisation and sedentariness. Moreover, the local and contemporary manifestations of this social and historical context are revealed in many of the elements that permeate not only the traditional samurai films of Kurosawa, Mizoguchi or Kobayashi, but modern adaptations of the genre as well, which tend to convey a nostalgic mourning for this loss, or more precisely, for this failure to adapt. Thus the filmic atmosphere of Ghost Dog is dominated by the negative qualities of inaction, nonviolence and sobriety, and whether these are taken to express the sterility and impotence of postmodern existence or the emptiness of a nostalgia for an unbroken and heroic past, these qualities point squarely towards the transience of culture and towards the impossibility of adaptation and survival. Ghost Dog is a reluctant assassin, and the inherently violent nature of his task is always deflected. In the same way, most of Ghost Dog’s speech in the film is delivered through his soundless readings of the Hagakure, silent and austere moments that mirror as well the creeping, sterile atmosphere in which most of the film’s action takes place. It is an atmosphere of interiority that points not only towards the stratified environment which restricts possibility and expressivity but also squarely towards the meaning of Bushido as code. But this atmosphere meets resistance. For the samurai is above all a man of war, and, as Deleuze and Guattari suggest, “the man of war [that is to say, the nomad] is always committing an offence against” the State (383). In Ghost Dog, for all the ways in which Ghost Dog’s experience is stratified by the Bushido as code and by the post-industrial urban reality in which he lives and moves, the film shows equally the extent to which these strata or codes are undermined by nomadic forces that trace “lines of flight” and escape (Deleuze and Guattari, 423). Clearly it is the film’s soundtrack, and thus, too, the aesthetic intensities of the flow in hip-hop music, which both constitute and facilitate this escape: We have an APB on an MC killer Looks like the work of a master … Merciless like a terrorist Hard to capture the flow Changes like a chameleon (“Da Mystery of Chessboxin,” Enter) Herein lies the significance of (and difference between) the meaning of Bushido as code and as way, a problem of adaptation and translation which clearly reflects the central conflict of the film. A way is always a way out, the very essence of escape, and it always facilitates the breaking away from a code. Deleuze and Guattari describe the nomad as problematic, hydraulic, inseparable from flow and heterogeneity; nomad elements, as those elements which the State is incapable of drawing into its interior, are said to remain exterior and excessive to it (361-2). It is thus significant that the interiority of Ghost Dog’s readings from the Hagakure and the ferocious exteriority of the soundtrack, which along with the Japanese text helps narrate the tale, reflect the same relationship that frames the state and nomad models. The Hagakure is not only read in silence by the protagonist throughout the film, but the Hagakure also figures prominently inside the diegetic world of the film as a visual element, whereas the soundtrack, whether it is functioning diegetically or non-diegetically, is by its very nature outside the narrative space of the film, effectively escaping it. For Deleuze and Guattari, musical expression is inseparable from a process of becoming, and, in fact, it is fair to say that the jouissance of the film is supplied wholly by the soundtrack insofar as it deterritorialises the conventional language of the genre, takes it outside of itself, and then reinvests it through updated musical flows that facilitate Ghost Dog’s becoming-samurai. In this way, too, the soundtrack expresses the violence and action that the plot carefully avoids and thus intimately relates the extreme interiority of the protagonist to an outside, a nomadic exterior that forecloses any possibility of nostalgia but which suggests rather a tactics of metamorphosis and immediacy, a sublime deterritorialisation that involves music becoming-world and world becoming-music. Throughout the film, the appearance of the nomad is accompanied, even announced, by the onset of a hip-hop musical flow, always cinematically represented by Ghost Dog’s traversing the city streets or by lengthy tracking shots of a passenger pigeon in flight, both of which, to take just two examples, testify to purely nomadic concepts: not only to the sheer smoothness of open sky-space and flight with its techno-spiritual connotations, but also to invisible, inherited pathways that cross the stratified heart of the city undetected and untraceable. Embodied as it is in the Ghost Dog soundtrack, and grounded in what I have chosen to call an aesthetics of flow, hip-hop is no arbitrary force in the film; it is rather both the adaptive medium through which Ghost Dog and the samurai genre are redeemed and the very expression of this adaptation. Deleuze and Guattari write: The necessity of not having control over language, of being a foreigner in one’s own tongue, in order to draw speech to oneself and ‘bring something incomprehensible into the world.’ Such is the form of exteriority … that forms a war machine. (378) Nowhere else do Deleuze and Guattari more clearly outline the affinities that bind their notion of the nomad and the form of exteriority that is essential to it with the politics of language, cultural difference and authenticity which so color theories of race and critical analyses of hip-hop music and culture. And thus the key to hip-hop’s adaptive power lies in its spontaneity and in its bringing into the world of something incomprehensible and unanticipated. If the code in Ghost Dog is depicted as nonviolent, striated, interior, singular, austere and measured, then the flow in hip-hop and in the music of the Wu-Tang that informs Ghost Dog’s soundtrack is violent, fluid, exterior, variable, plural, playful and incalculable. The flow in hip-hop, as well as in Deleuze and Guattari’s work, is grounded in a kinetic linguistic spontaneity, variation and multiplicity. Its lyrical flow is a cascade of accelerating rhymes, the very speed and implausibility of which often creates a sort of catharsis in performers and spectators: I bomb atomically, Socrates’ philosophies and hypotheses can’t define how I be droppin’ these mockeries, lyrically perform armed robberies Flee with the lottery, possibly they spotted me Battle-scarred shogun, explosion. … (“Triumph”, Forever) Over and against the paradigm of the samurai, which as I have shown is connected with relations of content and interiority, the flow is attested to even more explicitly in the Wu-Tang’s embrace of the martial arts, kung-fu and Chinese cinematic traditions. And any understanding of the figure of the samurai in the contemporary hip-hop imagination must contend with the relationship of this figure to both the kung-fu fighting traditions and to kung-fu cinema, despite the fact that they constitute very different cultural and historical forms. I would, of course, argue that it is precisely this playful adaptation or literal deterritorialisation of otherwise geographically and culturally distinct realities that comprises the adaptive potential of hip-hop. Kung-fu, like hip-hop, is predicated on the exteriority of style. It is also a form of action based on precision and immediacy, on the fluid movements of the body itself deterritorialised as weapon, and thus it reiterates that blend of violence, speed and fluidity that grounds the hip-hop aesthetic: “I’ll defeat your rhyme in just four lines / Yeh, I’ll wax you and tax you and plus save time” (RZA and Norris, 211). Kung-fu lends itself to improvisation and to adaptability, essential qualities of combat and of lyrical flows in hip-hop music. For example, just as in kung-fu combat a fighter’s success is fundamentally determined by his ability to intuit and adapt to the style and skill and detailed movements of his adversary, the victory of a hip-hop MC engaged in, say, a freestyle battle will be determined by his capacity for improvising and adapting his own lyrical flow to counter and overcome his opponent’s. David Bordwell not only draws critical lines of difference between the Hong Kong and Hollywood action film but also hints at the striking differences between the “delirious kinetic exhilaration” of Hong Kong cinema and the “sober, attenuated, and grotesque expressivity” of the traditional Japanese samurai film (91-2). Moreover, Bordwell emphasises what the Wu-Tang Clan has always known and demonstrated: the sympathetic bond between kung-fu action or hand-to-hand martial arts combat and the flow in hip-hop music. Bordwell calls his kung-fu aesthetic “expressive amplification”, which communicates with the viewer through both a visual and physical intelligibility and which is described by Bordwell in terms of beats, exaggerations, and the “exchange and rhyming of gestures” (87). What is pointed to here are precisely those aspects of Hong Kong cinema that share essential similarities with hip-hop music as such and which permeate the Wu-Tang aesthetic and thus, too, challenge or redistribute the codified stillness and negativity that define the filmic atmosphere of Ghost Dog. Bordwell argues that Hong Kong cinema constitutes an aesthetics in action that “pushes beyond Western norms of restraint and plausibility,” and in light of my thesis, I would argue that it pushes beyond these same conventions in traditional Japanese cinema as well (86). Bruce Lee, too, in describing the difference between Chinese kung-fu and Japanese fighting forms in A Warrior’s Journey (Bruce Little, 2000) points to the latter’s regulatory principles of hesitation and segmentarity and to the former’s formlessness and shapelessness, describing kung-fu when properly practiced as “like water, it can flow or it can crash,” qualities which echo not only Bordwell’s description of the pause-burst-pause pattern of kung-fu cinema’s combat sequences but also the Wu-Tang Clan’s own self-conception as described by GZA (“ji*zza”), a close relative of RZA and co-founder of the Wu-Tang Clan, when he is asked to explain the inspiration for the title of his album Liquid Swords: Actually, ‘Liquid Swords’ comes from a kung-fu flick. … But the title was just … perfect. I was like, ‘Legend of a Liquid Sword.’ Damn, this is my rhymes. This is how I’m spittin’ it. We say the tongue is symbolic of the sword anyway, you know, and when in motion it produces wind. That’s how you hear ‘wu’. … That’s the wind swinging from the sword. The ‘Tang’, that’s when it hits an object. Tang! That’s how it is with words. (RZA and Norris, 67) Thus do two competing styles animate the aesthetic dynamics of the film Ghost Dog: The Way of the Samurai: an aesthetic of codified arrest and restraint versus an aesthetic of nomadic resistance and escape. The former finds expression in the film in the form of the cultural and historical meanings of the samurai tradition, defined by negation and attenuated sobriety, and in the “blank parody” (Otomo, 35) of a postmodern nostalgia for an empty historical past exemplified in the appropriation of the Samurai theme and in the post-industrial prohibitions and stratifications of contemporary life and experience; the latter is attested to in the affirmative kinetic exhilaration of kung-fu style, immediacy and expressivity, and in the corresponding adaptive potential of a hip-hop musical flow, a distributive, productive, and anti-nostalgic becoming, the nomadic essence of which redeems the rhetoric of postmodern loss described by the film. References Bordwell, David. “Aesthetics in Action: Kungfu, Gunplay, and Cinematic Expressivity.” At Full Speed: Hong Kong Cinema in a Borderless World. Ed. and Trans. Esther Yau. Minneapolis: Minnesota UP, 2004. Bruce Lee: A Warrior’s Journey. Dir./Filmmaker John Little. Netflix DVD. Warner Home Video, 2000. Daidjo, Yuzan. Code of the Samurai. Trans. Thomas Cleary. Tuttle Martial Arts. Boston: Tuttle, 1999. Deleuze, Gilles, and Félix Guattari. A Thousand Plateaus. Trans. Brian Massumi. Minneapolis: Minnesota UP,1987. Forman, Murray, and Mark Anthony Neal, eds. That’s the Joint!: The Hip-Hop Studies Reader. New York: Routledge, 2004. Ghost Dog: The Way of the Samurai. Dir. Jim Jarmusch. Netflix DVD. Artisan, 2000. Hurst, G. Cameron III. Armed Martial Arts of Japan. New Haven: Yale UP,1998. Ikegami, Eiko. The Taming of the Samurai. Cambridge: Harvard UP, 1995. Jansen, Marius, ed. Warrior Rule in Japan. Cambridge: Cambridge UP, 1995. Kurosawa, Akira. Seven Samurai and Other Screenplays. Trans. Donald Richie. London: Faber and Faber, 1992. Lanzagorta, Marco. “Ghost Dog: The Way of the Samurai.” Senses of Cinema. Sept-Oct 2002. http://www.sensesofcinema.com/contents/cteq/02/22/ghost_dog.htm>. Mol, Serge. Classical Fighting Arts of Japan. Tokyo/New York: Kodansha Int., 2001. Otomo, Ryoko. “‘The Way of the Samurai’: Ghost Dog, Mishima, and Modernity’s Other.” Japanese Studies 21.1 (May 2001) 31-43. Potter, Russell. Spectacular Vernaculars. Albany: SUNY P, 1995. RZA, The, and Chris Norris. The Wu-Tang Manual. New York: Penguin, 2005. Silver, Alain. The Samurai Film. Woodstock, New York: Overlook, 1983. Smith, Christopher Holmes. “Method in the Madness: Exploring the Boundaries of Identity in Hip-Hop Performativity.” Social Identities 3.3 (Oct 1997): 345-75. Watkins, Craig S. Representing: Hip Hop Culture and the Production of Black Cinema. Chicago: Chicago UP, 1998. Wu-Tang Clan. Enter the Wu-Tang: 36 Chambers. CD. RCA/Loud Records, 1993. ———. Wu-Tang Forever. CD. RCA/Loud Records, 1997. Xing, Yan, ed. Shaolin Kungfu. Trans. Zhang Zongzhi and Zhu Chengyao. Beijing: China Pictorial, 1996. Citation reference for this article MLA Style Eubanks, Kevin P. "Becoming-Samurai: Samurai (Films), Kung-Fu (Flicks) and Hip-Hop (Soundtracks)." M/C Journal 10.2 (2007). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0705/11-eubanks.php>. APA Style Eubanks, K. (May 2007) "Becoming-Samurai: Samurai (Films), Kung-Fu (Flicks) and Hip-Hop (Soundtracks)," M/C Journal, 10(2). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0705/11-eubanks.php>.

35

Ngo, Giang, Melis Girbas, Hannah Schätzle, Andreas Hammer, Schara Safarian, Maximilian Hübinger, and Enrico Schleiff. "The Two TpsB-like Proteins in Anabaena sp. PCC 7120 Are Involved in Secretion of Selected Substrates." Journal of Bacteriology, November30, 2020. http://dx.doi.org/10.1128/jb.00568-20.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The outer membrane of Gram-negative bacteria acts as an initial diffusion barrier that shields the cell from the environment. It contains many membrane-embedded proteins required for functionality of this system. These proteins serve as solute and lipid transporters or as machines for membrane insertion or secretion of proteins. The genome of Anabaena sp. PCC 7120 codes for two outer membrane transporters termed TpsB1 and TpsB2. Those belong to the family of the two-partner secretion system proteins which are characteristic for pathogenic bacteria. Because pathogenicity of Anabaena sp. PCC 7120 has not been reported, the function of these two cyanobacterial TpsB proteins was analyzed. TpsB1 is encoded by alr1659, while TpsB2 is encoded by all5116. The latter is part of a genomic region containing 11 genes encoding TpsA-like proteins. However, tpsB2 is transcribed independently of a tpsA gene-cluster. Bioinformatics analysis revealed the presence of at least 22 genes in Anabaena sp. PCC 7120 putatively coding for substrates of the TpsB-system suggesting a rather global function of the two TpsB proteins. Insertion of a plasmid into each of the two genes, respectively, resulted in phenotypes of altered outer membrane integrity and antibiotic resistance. In addition, the expression of genes coding for the Clp and Deg proteases is dysregulated in these mutants. Moreover, for two of the putative substrates a dependence of the secretion on functional TpsB proteins could be confirmed. We confirm the existence of a two-partner secretion system in Anabaena sp. PCC 7120 and predict a large pool of putative substrates. IMPORTANCE Cyanobacteria are important organisms for the ecosystem considering their contribution to carbon fixation and oxygen production, while at the same time some species produce compounds that are toxic to their environment. As a consequence, cyanobacteria overpopulation might negatively impact the diversity of natural communities. Thus, a detailed understanding of cyanobacterial interaction with the environment including other organisms is required to define their impact on ecosystems. While two-partner secretion systems are well known from pathogenic bacteria, we provide a first description of the cyanobacterial two-partner secretion system.

36

Mathur, Suchitra. "From British “Pride” to Indian “Bride”." M/C Journal 10, no.2 (May1, 2007). http://dx.doi.org/10.5204/mcj.2631.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The release in 2004 of Gurinder Chadha’s Bride and Prejudice marked yet another contribution to celluloid’s Austen mania that began in the 1990s and is still going strong. Released almost simultaneously on three different continents (in the UK, US, and India), and in two different languages (English and Hindi), Bride and Prejudice, however, is definitely not another Anglo-American period costume drama. Described by one reviewer as “East meets West”, Chadha’s film “marries a characteristically English saga [Austen’s Pride and Prejudice] with classic Bollywood format “transforming corsets to saris, … the Bennetts to the Bakshis and … pianos to bhangra beats” (Adarsh). Bride and Prejudice, thus, clearly belongs to the upcoming genre of South Asian cross-over cinema in its diasporic incarnation. Such cross-over cinema self-consciously acts as a bridge between at least two distinct cinematic traditions—Hollywood and Bollywood (Indian Hindi cinema). By taking Austen’s Pride and Prejudice as her source text, Chadha has added another dimension to the intertextuality of such cross-over cinema, creating a complex hybrid that does not fit neatly into binary hyphenated categories such as “Asian-American cinema” that film critics such as Mandal invoke to characterise diaspora productions. An embodiment of contemporary globalised (post?)coloniality in its narrative scope, embracing not just Amritsar and LA, but also Goa and London, Bride and Prejudice refuses to fit into a neat East versus West cross-cultural model. How, then, are we to classify this film? Is this problem of identity indicative of postmodern indeterminacy of meaning or can the film be seen to occupy a “third” space, to act as a postcolonial hybrid that successfully undermines (neo)colonial hegemony (Sangari, 1-2)? To answer this question, I will examine Bride and Prejudice as a mimic text, focusing specifically on its complex relationship with Bollywood conventions. According to Gurinder Chadha, Bride and Prejudice is a “complete Hindi movie” in which she has paid “homage to Hindi cinema” through “deliberate references to the cinema of Manoj Kumar, Raj Kapoor, Yash Chopra and Karan Johar” (Jha). This list of film makers is associated with a specific Bollywood sub-genre: the patriotic family romance. Combining aspects of two popular Bollywood genres, the “social” (Prasad, 83) and the “romance” (Virdi, 178), this sub-genre enacts the story of young lovers caught within complex familial politics against the backdrop of a nationalist celebration of Indian identity. Using a cinematic language that is characterised by the spectacular in both its aural and visual aspects, the patriotic family romance follows a typical “masala” narrative pattern that brings together “a little action and some romance with a touch of comedy, drama, tragedy, music, and dance” (Jaikumar). Bride and Prejudice’s successful mimicry of this language and narrative pattern is evident in film reviews consistently pointing to its being very “Bollywoodish”: “the songs and some sequences look straight out of a Hindi film” says one reviewer (Adarsh), while another wonders “why this talented director has reduced Jane Austen’s creation to a Bollywood masala film” (Bhaskaran). Setting aside, for the moment, these reviewers’ condemnation of such Bollywood associations, it is worthwhile to explore the implications of yoking together a canonical British text with Indian popular culture. According to Chadha, this combination is made possible since “the themes of Jane Austen’s novels are a ‘perfect fit’ for a Bollywood style film” (Wray). Ostensibly, such a comment may be seen to reinforce the authority of the colonial canonical text by affirming its transnational/transhistorical relevance. From this perspective, the Bollywood adaptation not only becomes a “native” tribute to the colonial “master” text, but also, implicitly, marks the necessary belatedness of Bollywood as a “native” cultural formation that can only mimic the “English book”. Again, Chadha herself seems to subscribe to this view: “I chose Pride and Prejudice because I feel 200 years ago, England was no different than Amritsar today” (Jha). The ease with which the basic plot premise of Pride and Prejudice—a mother with grown-up daughters obsessed with their marriage—transfers to a contemporary Indian setting does seem to substantiate this idea of belatedness. The spatio-temporal contours of the narrative require changes to accommodate the transference from eighteenth-century English countryside to twenty-first-century India, but in terms of themes, character types, and even plot elements, Bride and Prejudice is able to “mimic” its master text faithfully. While the Bennets, Bingleys and Darcy negotiate the relationship between marriage, money and social status in an England transformed by the rise of industrial capitalism, the Bakshis, Balraj and, yes, Will Darcy, undertake the same tasks in an India transformed by corporate globalisation. Differences in class are here overlaid with those in culture as a middle-class Indian family interacts with wealthy non-resident British Indians and American owners of multinational enterprises, mingling the problems created by pride in social status with prejudices rooted in cultural insularity. However, the underlying conflicts between social and individual identity, between relationships based on material expediency and romantic love, remain the same, clearly indicating India’s belated transition from tradition to modernity. It is not surprising, then, that Chadha can claim that “the transposition [of Austen to India] did not offend the purists in England at all” (Jha). But if the purity of the “master” text is not contaminated by such native mimicry, then how does one explain the Indian anglophile rejection of Bride and Prejudice? The problem, according to the Indian reviewers, lies not in the idea of an Indian adaptation, but in the choice of genre, in the devaluation of the “master” text’s cultural currency by associating it with the populist “masala” formula of Bollywood. The patriotic family romance, characterised by spectacular melodrama with little heed paid to psychological complexity, is certainly a far cry from the restrained Austenian narrative that achieves its dramatic effect exclusively through verbal sparring and epistolary revelations. When Elizabeth and Darcy’s quiet walk through Pemberley becomes Lalita and Darcy singing and dancing through public fountains, and the private economic transaction that rescues Lydia from infamy is translated into fisticuff between Darcy and Wickham in front of an applauding cinema audience, mimicry does smack too much of mockery to be taken as a tribute. It is no wonder then that “the news that [Chadha] was making Bride and Prejudice was welcomed with broad grins by everyone [in Britain] because it’s such a cheeky thing to do” (Jha). This cheekiness is evident throughout the film, which provides a splendid over-the-top cinematic translation of Pride and Prejudice that deliberately undermines the seriousness accorded to the Austen text, not just by the literary establishment, but also by cinematic counterparts that attempt to preserve its cultural value through carefully constructed period pieces. Chadha’s Bride and Prejudice, on the other hand, marries British high culture to Indian popular culture, creating a mimic text that is, in Homi Bhabha’s terms, “almost the same, but not quite” (86), thus undermining the authority, the primacy, of the so-called “master” text. This postcolonial subversion is enacted in Chadha’s film at the level of both style and content. If the adaptation of fiction into film is seen as an activity of translation, of a semiotic shift from one language to another (Boyum, 21), then Bride and Prejudice can be seen to enact this translation at two levels: the obvious translation of the language of novel into the language of film, and the more complex translation of Western high culture idiom into the idiom of Indian popular culture. The very choice of target language in the latter case clearly indicates that “authenticity” is not the intended goal here. Instead of attempting to render the target language transparent, making it a non-intrusive medium that derives all its meaning from the source text, Bride and Prejudice foregrounds the conventions of Bollywood masala films, forcing its audience to grapple with this “new” language on its own terms. The film thus becomes a classic instance of the colony “talking back” to the metropolis, of Caliban speaking to Prospero, not in the language Prospero has taught him, but in his own native tongue. The burden of responsibility is shifted; it is Prospero/audiences in the West that have the responsibility to understand the language of Bollywood without dismissing it as gibberish or attempting to domesticate it, to reduce it to the familiar. The presence in Bride and Prejudice of song and dance sequences, for example, does not make it a Hollywood musical, just as the focus on couples in love does not make it a Hollywood-style romantic comedy. Neither The Sound of Music (Robert Wise, 1965) nor You’ve Got Mail (Nora Ephron, 1998) corresponds to the Bollywood patriotic family romance that combines various elements from distinct Hollywood genres into one coherent narrative pattern. Instead, it is Bollywood hits like Dilwale Dulhaniya Le Jayenge (Aditya Chopra, 1995) and Pardes (Subhash Ghai, 1997) that constitute the cinema tradition to which Bride and Prejudice belongs, and against which backdrop it needs to be seen. This is made clear in the film itself where the climactic fight between Darcy and Wickham is shot against a screening of Manoj Kumar’s Purab Aur Paschim (East and West) (1970), establishing Darcy, unequivocally, as the Bollywood hero, the rescuer of the damsel in distress, who deserves, and gets, the audience’s full support, denoted by enthusiastic applause. Through such intertextuality, Bride and Prejudice enacts a postcolonial reversal whereby the usual hierarchy governing the relationship between the colony and the metropolis is inverted. By privileging through style and explicit reference the Indian Bollywood framework in Bride and Prejudice, Chadha implicitly minimises the importance of Austen’s text, reducing it to just one among several intertextual invocations without any claim to primacy. It is, in fact, perfectly possible to view Bride and Prejudice without any knowledge of Austen; its characters and narrative pattern are fully comprehensible within a well-established Bollywood tradition that is certainly more familiar to a larger number of Indians than is Austen. An Indian audience, thus, enjoys a home court advantage with this film, not the least of which is the presence of Aishwarya Rai, the Bollywood superstar who is undoubtedly the central focus of Chadha’s film. But star power apart, the film consolidates the Indian advantage through careful re-visioning of specific plot elements of Austen’s text in ways that clearly reverse the colonial power dynamics between Britain and India. The re-casting of Bingley as the British Indian Balraj re-presents Britain in terms of its immigrant identity. White British identity, on the other hand, is reduced to a single character—Johnny Wickham—which associates it with a callous duplicity and devious exploitation that provide the only instance in this film of Bollywood-style villainy. This re-visioning of British identity is evident even at the level of the film’s visuals where England is identified first by a panning shot that covers everything from Big Ben to a mosque, and later by a snapshot of Buckingham Palace through a window: a combination of its present multicultural reality juxtaposed against its continued self-representation in terms of an imperial tradition embodied by the monarchy. This reductionist re-visioning of white Britain’s imperial identity is foregrounded in the film by the re-casting of Darcy as an American entrepreneur, which effectively shifts the narratorial focus from Britain to the US. Clearly, with respect to India, it is now the US which is the imperial power, with London being nothing more than a stop-over on the way from Amritsar to LA. This shift, however, does not in itself challenge the more fundamental West-East power hierarchy; it merely indicates a shift of the imperial centre without any perceptible change in the contours of colonial discourse. The continuing operation of the latter is evident in the American Darcy’s stereotypical and dismissive attitude towards Indian culture as he makes snide comments about arranged marriages and describes Bhangra as an “easy dance” that looks like “screwing in a light bulb with one hand and patting a dog with the other.” Within the film, this cultural snobbery of the West is effectively challenged by Lalita, the Indian Elizabeth, whose “liveliness of mind” is exhibited here chiefly through her cutting comebacks to such disparaging remarks, making her the film’s chief spokesperson for India. When Darcy’s mother, for example, dismisses the need to go to India since yoga and Deepak Chopra are now available in the US, Lalita asks her if going to Italy has become redundant because Pizza Hut has opened around the corner? Similarly, she undermines Darcy’s stereotyping of India as the backward Other where arranged marriages are still the norm, by pointing out the eerie similarity between so-called arranged marriages in India and the attempts of Darcy’s own mother to find a wife for him. Lalita’s strategy, thus, is not to invert the hierarchy by proving the superiority of the East over the West; instead, she blurs the distinction between the two, while simultaneously introducing the West (as represented by Darcy and his mother) to the “real India”. The latter is achieved not only through direct conversational confrontations with Darcy, but also indirectly through her own behaviour and deportment. Through her easy camaraderie with local Goan kids, whom she joins in an impromptu game of cricket, and her free-spirited guitar-playing with a group of backpacking tourists, Lalita clearly shows Darcy (and the audience in the West) that so-called “Hicksville, India” is no different from the so-called cosmopolitan sophistication of LA. Lalita is definitely not the stereotypical shy retiring Indian woman; this jean-clad, tractor-riding gal is as comfortable dancing the garbha at an Indian wedding as she is sipping marguerites in an LA restaurant. Interestingly, this East-West union in Aishwarya Rai’s portrayal of Lalita as a modern Indian woman de-stabilises the stereotypes generated not only by colonial discourse but also by Bollywood’s brand of conservative nationalism. As Chadha astutely points out, “Bride and Prejudice is not a Hindi film in the true sense. That rikshawallah in the front row in Patna is going to say, ‘Yeh kya hua? Aishwarya ko kya kiya?’ [What did you do to Aishwarya?]” (Jha). This disgruntlement of the average Indian Hindi-film audience, which resulted in the film being a commercial flop in India, is a result of Chadha’s departures from the conventions of her chosen Bollywood genre at both the cinematic and the thematic levels. The perceived problem with Aishwarya Rai, as articulated by the plaintive question of the imagined Indian viewer, is precisely her presentation as a modern (read Westernised) Indian heroine, which is pretty much an oxymoron within Bollywood conventions. In all her mainstream Hindi films, Aishwarya Rai has conformed to these conventions, playing the demure, sari-clad, conventional Indian heroine who is untouched by any “anti-national” western influence in dress, behaviour or ideas (Gangoli,158). Her transformation in Chadha’s film challenges this conventional notion of a “pure” Indian identity that informs the Bollywood “masala” film. Such re-visioning of Bollywood’s thematic conventions is paralleled, in Bride and Prejudice, with a playfully subversive mimicry of its cinematic conventions. This is most obvious in the song-and-dance sequences in the film. While their inclusion places the film within the Bollywood tradition, their actual picturisation creates an audio-visual pastiche that freely mingles Bollywood conventions with those of Hollywood musicals as well as contemporary music videos from both sides of the globe. A song, for example, that begins conventionally enough (in Bollywood terms) with three friends singing about one of them getting married and moving away, soon transforms into a parody of Hollywood musicals as random individuals from the marketplace join in, not just as chorus, but as developers of the main theme, almost reducing the three friends to a chorus. And while the camera alternates between mid and long shots in conventional Bollywood fashion, the frame violates the conventions of stylised choreography by including a chaotic spill-over that self-consciously creates a postmodern montage very different from the controlled spectacle created by conventional Bollywood song sequences. Bride and Prejudice, thus, has an “almost the same, but not quite” relationship not just with Austen’s text but also with Bollywood. Such dual-edged mimicry, which foregrounds Chadha’s “outsider” status with respect to both traditions, eschews all notions of “authenticity” and thus seems to become a perfect embodiment of postcolonial hybridity. Does this mean that postmodern pastiche can fulfill the political agenda of postcolonial resistance to the forces of globalised (neo)imperialism? As discussed above, Bride and Prejudice does provide a postcolonial critique of (neo)colonial discourse through the character of Lalita, while at the same time escaping the trap of Bollywood’s explicitly articulated brand of nationalism by foregrounding Lalita’s (Westernised) modernity. And yet, ironically, the film unselfconsciously remains faithful to contemporary Bollywood’s implicit ideological framework. As most analyses of Bollywood blockbusters in the post-liberalisation (post-1990) era have pointed out, the contemporary patriotic family romance is distinct from its earlier counterparts in its unquestioning embrace of neo-conservative consumerist ideology (Deshpande, 187; Virdi, 203). This enthusiastic celebration of globalisation in its most recent neo-imperial avatar is, interestingly, not seen to conflict with Bollywood’s explicit nationalist agenda; the two are reconciled through a discourse of cultural nationalism that happily co-exists with a globalisation-sponsored rampant consumerism, while studiously ignoring the latter’s neo-colonial implications. Bride and Prejudice, while self-consciously redefining certain elements of this cultural nationalism and, in the process, providing a token recognition of neo-imperial configurations, does not fundamentally question this implicit neo-conservative consumerism of the Bollywood patriotic family romance. This is most obvious in the film’s gender politics where it blindly mimics Bollywood conventions in embodying the nation as a woman (Lalita) who, however independent she may appear, not only requires male protection (Darcy is needed to physically rescue Lakhi from Wickham) but also remains an object of exchange between competing systems of capitalist patriarchy (Uberoi, 207). At the film’s climax, Lalita walks away from her family towards Darcy. But before Darcy embraces the very willing Lalita, his eyes seek out and receive permission from Mr Bakshi. Patriarchal authority is thus granted due recognition, and Lalita’s seemingly bold “independent” decision remains caught within the politics of patriarchal exchange. This particular configuration of gender politics is very much a part of Bollywood’s neo-conservative consumerist ideology wherein the Indian woman/nation is given enough agency to make choices, to act as a “voluntary” consumer, within a globalised marketplace that is, however, controlled by the interests of capitalist patriarchy. The narrative of Bride and Prejudice perfectly aligns this framework with Lalita’s project of cultural nationalism, which functions purely at the personal/familial level, but which is framed at both ends of the film by a visual conjoining of marriage and the marketplace, both of which are ultimately outside Lalita’s control. Chadha’s attempt to appropriate and transform British “Pride” through subversive postcolonial mimicry, thus, ultimately results only in replacing it with an Indian “Bride,” with a “star” product (Aishwarya Rai / Bride and Prejudice / India as Bollywood) in a splendid package, ready for exchange and consumption within the global marketplace. All glittering surface and little substance, Bride and Prejudice proves, once again, that postmodern pastiche cannot automatically double as politically enabling postcolonial hybridity (Sangari, 23-4). References Adarsh, Taran. “Balle Balle! From Amritsar to L.A.” IndiaFM Movie Review 8 Oct. 2004. 19 Feb. 2007 http://indiafm.com/movies/review/7211/index.html>. Austen, Jane. Pride and Prejudice. 1813. New Delhi: Rupa and Co., 1999. Bhabha, Homi. “Of Mimicry and Man: The Ambivalence of Colonial Discourse.” The Location of Culture. Routledge: New York, 1994. 85-92. Bhaskaran, Gautam. “Classic Made Trivial.” The Hindu 15 Oct. 2004. 19 Feb. 2007 http://www.hinduonnet.com/thehindu/fr/2004/10/15/stories/ 2004101502220100.htm>. Boyum, Joy Gould. Double Exposure: Fiction into Film. Calcutta: Seagull Books, 1989. Bride and Prejudice. Dir. Gurinder Chadha. Perf. Aishwarya Ray and Martin Henderson. Miramax, 2004. Deshpande, Sudhanva. “The Consumable Hero of Globalized India.” Bollyworld: Popular Indian Cinema through a Transnational Lens. Eds. Raminder Kaur and Ajay J. Sinha. New Delhi: Sage, 2005. 186-203. Gangoli, Geetanjali. “Sexuality, Sensuality and Belonging: Representations of the ‘Anglo-Indian’ and the ‘Western’ Woman in Hindi Cinema.” Bollyworld: Popular Indian Cinema through a Transnational Lens. Eds. Raminder Kaur and Ajay J. Sinha. New Delhi: Sage, 2005. 143-162. Jaikumar, Priya. “Bollywood Spectaculars.” World Literature Today 77.3/4 (2003): n. pag. Jha, Subhash K. “Bride and Prejudice is not a K3G.” The Rediff Interview 30 Aug. 2004. 19 Feb. 2007 http://in.rediff.com/movies/2004/aug/30finter.htm>. Mandal, Somdatta. Film and Fiction: Word into Image. New Delhi: Rawat Publications, 2005. Prasad, M. Madhava. Ideology of the Hindi Film: A Historical Construction. New Delhi: Oxford UP, 1998. Sangari, Kumkum. Politics of the Possible: Essays on Gender, History, Narratives, Colonial English. New Delhi: Tulika, 1999. Uberoi, Patricia. Freedom and Destiny: Gender, Family, and Popular Culture in India. New Delhi: Oxford UP, 2006. Virdi, Jyotika. The Cinematic Imagination: Indian Popular Films as Social History. Delhi: Permanent Black, 2003. Wray, James. “Gurinder Chadha Talks Bride and Prejudice.” Movie News 7 Feb. 2005. 19 Feb. http://movies.monstersandcritics.com/news/article_4163.php/ Gurinder_Chadha_Talks_Bride_and_Prejudice>. Citation reference for this article MLA Style Mathur, Suchitra. "From British “Pride” to Indian “Bride”: Mapping the Contours of a Globalised (Post?)Colonialism." M/C Journal 10.2 (2007). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0705/06-mathur.php>. APA Style Mathur, S. (May 2007) "From British “Pride” to Indian “Bride”: Mapping the Contours of a Globalised (Post?)Colonialism," M/C Journal, 10(2). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0705/06-mathur.php>.

37

O'Meara, Radha. "Do Cats Know They Rule YouTube? Surveillance and the Pleasures of Cat Videos." M/C Journal 17, no.2 (March10, 2014). http://dx.doi.org/10.5204/mcj.794.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Did you see the videos where the cat jumps in the box, attacks the printer or tries to leap from the snowy car? As the availability and popularity of watching videos on the Internet has risen rapidly in the last decade, so has the prevalence of cat videos. Although the cuteness of YouTube videos of cats might make them appear frivolous, in fact there is a significant irony at their heart: online cat videos enable corporate surveillance of viewers, yet viewers seem just as oblivious to this as the cats featured in the videos. Towards this end, I consider the distinguishing features of contemporary cat videos, focusing particularly on their narrative structure and mode of observation. I compare cat videos with the “Aesthetic of Astonishment” of early cinema and with dog videos, to explore the nexus of a spectatorship of thrills and feline performance. In particular, I highlight a unique characteristic of these videos: the cats’ unselfconsciousness. This, I argue, is rare in a consumer culture dominated by surveillance, where we are constantly aware of the potential for being watched. The unselfconsciousness of cats in online videos offers viewers two key pleasures: to imagine the possibility of freedom from surveillance, and to experience the power of administering surveillance as unproblematic. Ultimately, however, cat videos enable viewers to facilitate our own surveillance, and we do so with the gleeful abandon of a kitten jumping in a tissue box What Distinguishes Cat Videos? Cat videos have become so popular, that they generate millions of views on YouTube, and the Walker Art Center in Minneapolis now holds an annual Internet Cat Video Festival. If you are not already a fan of the genre, the Walker’s promotional videos for the festival (2013 and 2012) provide an entertaining introduction to the celebrities (Lil Bub, Grumpy Cat, and Henri), canon (dancing cats, surprised cat, and cat falling off counter), culture and commodities of online cat videos, despite repositioning them into a public exhibition context. Cats are often said to dominate the internet (Hepola), despite the surprise of Internet inventor Tim Berners-Lee. Domestic cats are currently the most popular pet in the world (Driscoll), however they are already outnumbered by smartphones. Cats have played various roles in our societies, cultures and imaginations since their domestication some 8-10,000 years ago (Driscoll). A potent social and cultural symbol in mythology, art and popular culture, the historical and cultural significance of cats is complex, shifting and often contradictory. They have made their way across geographic, cultural and class boundaries, and been associated with the sacred and the occult, femininity and fertility, monstrosity and domesticity (Driscoll, Rogers). Cats are figured as both inscrutable and bounteously polysemic. Current representations of cats, including these videos, seem to emphasise their sociability with humans, association with domestic space, independence and aloofness, and intelligence and secretiveness. I am interested in what distinguishes the pleasures of cat videos from other manifestations of cats in folklore and popular culture such as maneki-neko and fictional cats. Even within Internet culture, I’m focusing on live action cat videos, rather than lolcats, animated cats, or dog videos, though these are useful points of contrast. The Walker’s cat video primer also introduces us to the popular discourses accounting for the widespread appeal of these videos: cats have global reach beyond language, audiences can project their own thoughts and feelings onto cats, cats are cute, and they make people feel good. These discourses circulate in popular conversation, and are promoted by YouTube itself. These suggestions do not seem to account for the specific pleasures of cat videos, beyond the predominance of cats in culture more broadly. The cat videos popular on the Internet tend to feature several key characteristics. They are generated by users, shot on a mobile device such as a phone, and set in a domestic environment. They employ an observational mode, which Bill Nichols has described as a noninterventionist type of documentary film associated with traditions of direct cinema and cinema verite, where form and style yields to the profilmic event. In the spirit of their observational mode, cat videos feature minimal sound and language, negligible editing and short duration. As Leah Shafer notes, cat videos record, “’live’ events, they are mostly shot by ‘amateurs’ with access to emerging technologies, and they dramatize the familiar.” For example, the one-minute video Cat vs Printer comprises a single, hand-held shot observing the cat, and the action is underlined by the printer’s beep and the sounds created by the cat’s movements. The patterned wallpaper suggests a domestic location, and the presence of the cat itself symbolises domesticity. These features typically combine to produce impressions of universality, intimacy and spontaneity – impressions commonly labelled ‘cute’. The cat’s cuteness is also embodied in its confusion and surprise at the printer’s movements: it is a simpleton, and we can laugh at its lack of understanding of the basic appurtenances of the modern world. Cat videos present minimalist narratives, focused on an instant of spectacle. A typical cat video establishes a state of calm, then suddenly disrupts it. The cat is usually the active agent of change, though chance also frequently plays a significant role. The pervasiveness of this structure means that viewers familiar with the form may even anticipate a serendipitous event. The disruption prompts a surprising or comic effect for the viewer, and this is a key part of the video’s pleasure. For example, in Cat vs Printer, the establishing scenario is the cat intently watching the printer, a presumably quotidian scene, which escalates when the cat begins to smack the moving paper. The narrative climaxes in the final two seconds of the video, when the cat strikes the paper so hard that the printer tray bounces, and the surprised cat falls off its stool. The video ends abruptly. This disruption also takes the viewer by surprise (at least it does the first time you watch it). The terse ending, and lack of resolution or denouement, encourages the viewer to replay the video. The minimal narrative effectively builds expectation for a moment of surprise. These characteristics of style and form typify a popular body of work, though there is variation, and the millions of cat videos on YouTube might be best accounted for by various subgenres. The most popular cat videos seem to have the most sudden and striking disruptions as well as the most abrupt endings. They seem the most dramatic and spontaneous. There are also thousands of cat videos with minor disruptions, and some with brazenly staged events. Increasingly, there is obvious use of postproduction techniques, including editing and music. A growing preponderance of compilations attests to the videos’ “spreadability” (Jenkins, Ford, and Green). The conventional formal structure of these videos effectively hom*ogenises the cat, as if there is a single cat performing in millions of videos. Indeed, YouTube comments often suggest a likeness between the cat represented in the video and the commenter’s own cat. In this sense, the cuteness so readily identified has an hom*ogenising effect. It also has the effect of distinguishing cats as a species from other animals, as it confounds common conceptions of all (other) animals as fundamentally alike in their essential difference from the human (animal). Cat videos are often appreciated for what they reveal about cats in general, rather than for each cat’s individuality. In this way, cat videos symbolise a generic feline cuteness, rather than identify a particular cat as cute. The cats of YouTube act “as an allegory for all the cats of the earth, the felines that traverse myths and religions, literature and fables” (Derrida 374). Each cat swiping objects off shelves, stealing the bed of a dog, leaping onto a kitchen bench is the paradigmatic cat, the species exemplar. Mode of Spectatorship, Mode of Performance: Cat Videos, Film History and Dog Videos Cat videos share some common features with early cinema. In his analysis of the “Aesthetic of Astonishment,” which dominated films until about 1904, film historian Tom Gunning argues that the short, single shot films of this era are characterised by exciting audience curiosity and fulfilling it with visual shocks and thrills. It is easy to see how this might describe the experience of watching Cat vs Printer or Thomas Edison’s Electrocution of an Elephant from 1903. The thrill of revelation at the end of Cat vs Printer is more significant than the minimal narrative it completes, and the most popular videos seem to heighten this shock. Further, like a rainy afternoon spent clicking the play button on a sequence of YouTube’s suggested videos, these early short films were also viewed in variety format as a series of attractions. Indeed, as Leah Shafer notes, some of these early films even featured cats, such as Professor Welton’s Boxing Cats from 1894. Each film offered a moment of spectacle, which thrilled the modern viewer. Gunning argues that these early films are distinguished by a particular relationship between spectator and film. They display blatant exhibitionism, and address their viewer directly. This highlights the thrill of disruption: “The directness of this act of display allows an emphasis on the thrill itself – the immediate reaction of the viewer” (Gunning “Astonishment” 122). This is produced both within the staging of the film itself as players look directly at the camera, and by the mode of exhibition, where a showman primes the audience verbally for a moment of revelation. Importantly, Gunning argues that this mode of spectatorship differs from how viewers watch narrative films, which later came to dominate our film and television screens: “These early films explicitly acknowledge their spectator, seeming to reach outwards and confront. Contemplative absorption is impossible here” (“Astonishment” 123). Gunning’s emphasis on a particular mode of spectatorship is significant for our understanding of pet videos. His description of early cinema has numerous similarities with cat videos, to be sure, but seems to describe more precisely the mode of spectatorship engendered by typical dog videos. Dog videos are also popular online, and are marked by a mode of performance, where the dogs seem to present self-consciously for the camera. Dogs often appear to look at the camera directly, although they are probably actually reading the eyes of the camera operator. One of the most popular dog videos, Ultimate dog tease, features a dog who appears to look into the camera and engage in conversation with the camera operator. It has the same domestic setting, mobile camera and short duration as the typical cat video, but, unlike the cat attacking the printer, this dog is clearly aware of being watched. Like the exhibitionistic “Cinema of Attractions,” it is marked by “the recurring look at the camera by [canine] actors. This action which is later perceived as spoiling the realistic illusion of the cinema, is here undertaken with brio, establishing contact with the audience” (Gunning “Attractions” 64). Dog videos frequently feature dogs performing on command, such as the countless iterations of dogs fetching beverages from refrigerators, or at least behaving predictably, such as dogs jumping in the bath. Indeed, the scenario often seems to be set up, whereas cat videos more often seem to be captured fortuitously. The humour of dog videos often comes from the very predictability of their behaviour, such as repeatedly fetching or rolling in mud. In an ultimate performance of self-consciousness, dogs even seem to act out guilt and shame for their observers. Similarly, baby videos are also popular online and were popular in early cinema, and babies also tend to look at the camera directly, showing that they are aware of bring watched. This emphasis on exhibitionism and modes of spectatorship helps us hone in on the uniqueness of cat videos. Unlike the dogs of YouTube, cats typically seem unaware of their observers; they refuse to look at the camera and “display their visibility” (Gunning “Attractions,” 64). This fits with popular discourses of cats as independent and aloof, untrainable and untameable. Cat videos employ a unique mode of observation: we observe the cat, who is unencumbered by our scrutiny. Feline Performance in a World of Pervasive Surveillance This is an aesthetic of surveillance without inhibition, which heightens the impressions of immediacy and authenticity. The very existence of so many cat videos online is a consequence of camera ubiquity, where video cameras have become integrated with common communications devices. Thousands of cameras are constantly ready to capture these quotidian scenes, and feed the massive economy of user-generated content. Cat videos are obviously created and distributed by humans, a purposeful labour to produce entertainment for viewers. Cat videos are never simply a feline performance, but a performance of human interaction with the cat. The human act of observation is an active engagement with the other. Further, the act of recording is a performance of wielding the camera, and often also through image or voice. The cat video is a companion performance, which is part of an ongoing relationship between that human and that other animal. It carries strong associations with regimes of epistemological power and physical domination through histories of visual study, mastery and colonisation. The activity of the human creator seems to contrast with the behaviour of the cat in these videos, who appears unaware of being watched. The cats’ apparent uninhibited behaviour gives the viewer the illusion of voyeuristically catching a glimpse of a self-sufficient world. It carries connotations of authenticity, as the appearance of interaction and intervention is minimised, like the ideal of ‘fly on the wall’ documentary (Nichols). This lack of self-consciousness and sense of authenticity are key to their reception as ‘cute’ videos. Interestingly, one of the reasons that audiences may find this mode of observation so accessible and engaging, is because it heeds the conventions of the fourth wall in the dominant style of fiction film and television, which presents an hermetically sealed diegesis. This unselfconscious performance of cats in online videos is key, because it embodies a complex relationship with the surveillance that dominates contemporary culture. David Lyon describes surveillance as “any focused attention to personal details for the purposes of influence, management, or control” (“Everyday” 1) and Mark Andrejevic defines monitoring as “the collection of information, with or without the knowledge of users, that has actual or speculative economic value” (“Enclosure” 297). We live in an environment where social control is based on information, collected and crunched by governments, corporations, our peers, and ourselves. The rampancy of surveillance has increased in recent decades in a number of ways. Firstly, technological advances have made the recording, sorting and analysis of data more readily available. Although we might be particularly aware of the gaze of the camera when we stand in line at the supermarket checkout or have an iPhone pointed at our face, many surveillance technologies are hidden points of data collection, which track our grocery purchases, text messages to family and online viewing. Surveillance is increasingly mediated through digital technologies. Secondly, surveillance data is becoming increasingly privatised and monetised, so there is strengthening market demand for consumer information. Finally, surveillance was once associated chiefly with institutions of the state, or with corporations, but the process is increasingly “lateral,” involving peer-to-peer surveillance and self-surveillance in the realms of leisure and domestic life (Andrejevic “Enclosure,” 301). Cat videos occupy a fascinating position within this context of pervasive surveillance, and offer complex thrills for audiences. The Unselfconscious Pleasures of Cat Videos Unselfconsciousness of feline performance in cat videos invites contradictory pleasures. Firstly, cat videos offer viewers the fantasy of escaping surveillance. The disciplinary effect of surveillance means that we modify our behaviour based on a presumption of constant observation; we are managed and manipulated as much by ourselves as we are by others. This discipline is the defining condition of industrial society, as described by Foucault. In an age of traffic cameras, Big Brother, CCTV, the selfie pout, and Google Glass, modern subjects are oppressed by the weight of observation to constantly manage their personal performance. Unselfconsciousness is associated with privacy, intimacy, naivety and, increasingly, with impossibility. By allowing us to project onto the experience of their protagonists, cat videos invite us to imagine a world where we are not constantly aware of being watched, of being under surveillance by both human beings and technology. This projection is enabled by discourse, which constructs cats as independent and aloof, a libertarian ideal. It provides the potential for liberation from technologized social surveillance, and from the concomitant self-discipline of our docile bodies. The uninhibited performance of cats in online videos offers viewers the prospect that it is possible to live without the gaze of surveillance. Through cat videos, we celebrate the untameable. Cats model a liberated uninhibitedness viewers can only desire. The apparent unselfconsciousness of feline performance is analogous to Derrida’s conception of animal nakedness: the nudity of animals is significant, because it is a key feature which distinguishes them from humans, but at the same time there is no sense of the concept of nakedness outside of human culture. Similarly, a performance uninhibited by observation seems beyond humans in contemporary culture, and implies a freedom from social expectations, but there is also little suggestion that cats would act differently if they knew they were observed. We interpret cats’ independence as natural, and take pleasure in cats’ naturalness. This lack of inhibition is cute in the sense that it is attractive to the viewer, but also in the sense that it is naïve to imagine a world beyond surveillance, a freedom from being watched. Secondly, we take pleasure in the power of observing another. Surveillance is based on asymmetrical regimes of power, and the position of observer, recorder, collator is usually more powerful than the subject of their gaze. We enjoy the pleasure of wielding the unequal gaze, whether we hit the “record” button ourselves or just the “play” button. In this way, we celebrate our capacity to contain the cat, who has historically proven conceptually uncontainable. Yet, the cats’ unselfconsciousness means we can absolve ourselves of their exploitation. Looking back at the observer, or the camera, is often interpreted as a confrontational move. Cats in videos do not confront their viewer, do not resist the gaze thrown on them. They accept the role of subject without protest; they perform cuteness without resistance. We internalise the strategies of surveillance so deeply that we emulate its practices in our intimate relationships with domestic animals. Cats do not glare back at us, accusingly, as dogs do, to remind us we are exerting power over them. The lack of inhibition of cats in online videos means that we can exercise the power of surveillance without confronting the oppression this implies. Cat videos offer the illusion of watching the other without disturbing it, brandishing the weapon without acknowledging the violence of its impact. There is a logical tension between these dual pleasures of cat videos: we want to escape surveillance, while exerting it. The Work of Cat Videos in ‘Liquid Surveillance’ These contradictory pleasures in fact speak to the complicated nature of surveillance in the era of “produsage,” when the value chain of media has transformed along with traditional roles of production and consumption (Bruns). Christian Fuchs argues that the contemporary media environment has complicated the dynamics of surveillance, and blurred the lines between subject and object (304). We both create and consume cat videos; we are commodified as audience and sold on as data. YouTube is the most popular site for sharing cat videos, and a subsidiary of Google, the world’s most visited website and a company which makes billions of dollars from gathering, collating, storing, assessing, and trading our data. While we watch cat videos on YouTube, they are also harvesting information about our every click, collating it with our other online behaviour, targeting ads at us based on our specific profile, and also selling this data on to others. YouTube is, in fact, a key tool of what David Lyon calls “liquid surveillance” after the work of Zygmunt Bauman, because it participates in the reduction of millions of bodies into data circulating at the service of consumer society (Lyon “Liquid”). Your views of cats purring and pouncing are counted and monetised, you are profiled and targeted for further consumption. YouTube did not create the imbalance of power implied by these mechanisms of surveillance, but it is instrumental in automating, amplifying, and extending this power (Andrejevic “Lateral,” 396). Zygmunt Bauman argues that in consumer society we are increasingly seduced to willingly subject ourselves to surveillance (Lyon “Liquid”), and who better than the cute kitty to seduce us? Our increasingly active role in “produsage” media platforms such as YouTube enables us to perform what Andrejevic calls “the work of being watched” (“Work”). When we upload, play, view, like and comment on cat videos, we facilitate our own surveillance. We watch cat videos for the contradictory pleasures they offer us, as we navigate and negotiate the overwhelming surveillance of consumer society. Cat videos remind us of the perpetual possibility of observation, and suggest the prospect of escaping it. ReferencesAndrejevic, Mark. “The Work of Being Watched: Interactive Media and the Exploitation of Self-Disclosure.” Critical Studies in Media Communication 19.2 (2002): 230-248. Andrejevic, Mark. “The Discipline of Watching: Detection, Risk, and Lateral Surveillance.” Critical Studies in Media Communication 23.5 (2006): 391-407. Andrejevic, Mark. “Surveillance in the Digital Enclosure.” The Communication Review 10.4 (2007): 295-317. Berners-Lee, Tim. “Ask Me Anything.” Reddit, 12 March 2014. 29 Apr. 2014 ‹http://www.reddit.com/r/IAmA/comments/2091d4/i_am_tim_bernerslee_i_invented_the_www_25_years/cg0wpma›. Bruns, Axel. Blogs, Wikipedia, Second Life and Beyond: From Production to Produsage. New York: Peter Lang, 2008. Derrida, Jacques. The Animal That Therefore I Am. New York: Fordham University Press, 2008. Project MUSE, 4 Mar. 2014. 29 Apr. 2014 ‹http://muse.jhu.edu/›. Driscoll, Carlos A., et al. "The Taming of the Cat." Scientific American 300.6 (2009): 68-75. Foucault, Michel. Discipline and Punish: The Birth of the Prison. Trans. Alan Sheridan. New York: Random House, 1995. Fuchs, Christian. “Web 2.0, Prosumption, and Surveillance.” Surveillance & Society 8.3 (2011): 288-309. Gunning, Tom. “An Aesthetic of Astonishment: Early Film and the Incredulous Spectator.” Viewing Positions: Ways of Seeing Film. Ed. Linda Williams. New Brunswick, NJ: Rutgers UP, 1995. 114-133. Gunning, Tom. "The Cinema of Attractions: Early Film, Its Spectator and the Avant-Garde." Wide Angle 8.3-4 (1986): 63-70. Hepola, Sarah. “The Internet Is Made of Kittens.” Salon, 11 Feb 2009. 29 Apr. 2014 ‹http://www.salon.com/2009/02/10/cat_internet/›. Jenkins, Henry, Sam Ford, and Joshua Green. Spreadable Media: Creating Value and Meaning in a Network Culture. New York: NYU Press, 2013. Lyon, David. “Liquid Surveillance: The Contribution of Zygmunt Bauman to Surveillance Studies.” International Political Sociology 4 (2010): 325–338 Lyon, David. “Surveillance, Power and Everyday Life.” In Robin Mansell et al., eds., Oxford Handbook of Information and Communication Technologies. Oxford: Oxford Handbooks, 2007. 449-472. 29 Apr. 2014 ‹http://www.sscqueens.org/sites/default/files/oxford_handbook.pdf›. Nichols, Bill. Introduction to Documentary. 2nd ed. Bloomington: Indiana University Press, 2010. Rogers, Katharine. The Cat and the Human Imagination: Feline Images from Bast to Garfield. Ann Arbor, MI: University of Michigan Press, 2001. Shafer, Leah. “I Can Haz an Internet Aesthetic?!? LOLCats and the Digital Marketplace.” Paper presented at the Northeast Popular/American Culture Association Conference, St. John Fisher College, Rochester, New York, 2012. 5 Mar. 2014 ‹http://fisherpub.sjfc.edu/cgi/viewcontent.cgi?article=1094&context=nepca›.

38

Morton, Kimberley. "PANIC by S. Draper." Deakin Review of Children's Literature 5, no.1 (July16, 2015). http://dx.doi.org/10.20361/g28c8z.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Draper, Sharon M. PANIC. New York: Atheneum Books for Young Readers, 2013. Print.Imagine ... waking up, tied to a bed, groggy, naked, and alone. What would you do?PANIC is a gripping tale of two teenage girls and their experience with manipulation, abduction, and abuse. After meeting Thane, the handsome Hollywood movie director, 15-year-old Diamond is easily persuaded to accompany him back to his family's home to audition for an exciting part in upcoming movie. It's a dream come true for the aspiring dancer! Diamond ignores everything she's been taught since she was a little girl, and willingly gets into a car with the stranger. Still unaware of the looming danger, Diamond is lured into Thane's house, accepts a drink, and then pays the unthinkable price for the promise of starring in a Hollywood movie. She is now being held captive and forced to "play her part" in Thane's horrifying production, all while her family and friends, who are desperately waiting for news of her safety, live through their own horrors and traumas. While each girl fights for escape from their own personal prison, they desperately search for an inner strength they hope is there. From the award-winning, New York Times bestselling author, Sharon M. Draper, this is a heart-breaking story that quickly turns into an exhilarating examination of power and loss, and the inspiring fight to take it all back.Sharon M. Draper's PANIC is a heart-pounding saga that will easily appeal to a wide age and range of readers. Defined as hi-lo contemporary fiction, it is a novel originally written for a young adult audience, and is a story that addresses important issues like abduction, sexual abuse, and bullying. It is a book that teaches valuable lessons, and so, may also appeal to parents and caregivers, and act as an important discussion piece for families. While offering insightful symbolism and the opportunity to dig deep into heavy themes (like the objectification of women and abusive teen relationships), it will work well for strong and inquisitive readers, however, with its short chapters, sobering plot, and strong young characters, this novel will attract many reluctant readers who are looking for a quick yet interesting read. Although the action is intense, emotional, and distressing at times the ease of dialogue and growth of the characters draws the reader in and forces them to think about their own risky behaviour, and the potential for resulting danger. Be aware that the trivial language used too often by the young characters can become tedious and annoying, and with a religious element to the book, some readers may feel uncomfortable at certain points. Yet, it is Draper's ability to so vividly capture the mind and heart of the adolescent, and the important and powerful life lessons the story delivers, that makes PANIC a must-have addition to any collection.Highly Recommended: 4 out of 4 StarsReviewer: Kimberley K. MortonKim Morton is a secondary History teacher and Learning Coordinator with the Saskatoon Public School Division. She is currently working toward her Masters of Education, specializing in Teacher-Librarianship, through the University of Alberta. She strives to make research and inquiry meaningful, relevant, and fun for her students, and is looking to gain more experience with current technology, trends, and tools. She enjoys sports, is an avid reader of historical novels, and loves going to the movies.

39

Wessell, Adele. "Making a Pig of the Humanities: Re-centering the Historical Narrative." M/C Journal 13, no.5 (October18, 2010). http://dx.doi.org/10.5204/mcj.289.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

As the name suggests, the humanities is largely a study of the human condition, in which history sits as a discipline concerned with the past. Environmental history is a new field that brings together scholars from a range of disciplines to consider the changing relationships between humans and the environment over time. Critiques of anthropocentrism that place humans at the centre of the universe or make assessments through an exclusive human perspective provide a challenge to scholars to rethink our traditional biases against the nonhuman world. The movement towards nonhumanism or posthumanism, however, does not seem to have had much of an impression on history as a discipline. What would a nonhumanist history look like if we re-centred the historical narrative around pigs? There are histories of pigs as food (see for example, The Cambridge History of Food which has a chapter on “Hogs”). There are food histories that feature pork in terms of its relationship to multiethnic identity (such as Donna Gabaccia’s We Are What We Eat) and examples made of pigs to promote ethical eating (Singer). Pigs are central to arguments about dietary rules and what motivates them (Soler; Dolander). Ancient pig DNA has also been employed in studies on human migration and colonisation (Larson et al.; Durham University). Pigs are also widely used in a range of products that would surprise many of us. In 2008, Christien Meindertsma spent three years researching the products made from a single pig. Among some of the more unexpected results were: ammunition, medicine, photographic paper, heart valves, brakes, chewing gum, porcelain, cosmetics, cigarettes, hair conditioner and even bio diesel. Likewise, Fergus Henderson, who coined the term ‘nose to tail eating’, uses a pig on the front cover of the book of that name to suggest the extraordinary and numerous potential of pigs’ bodies. However, my intention here is not to pursue a discussion of how parts of their bodies are used, rather to consider a reorientation of the historical narrative to place pigs at the centre of stories of our co-evolution, in order to see what their history might say about humans and our relationships with them. This is underpinned by recognition of the inter-relationality of humans and animals. The relationships between wild boar and pigs with humans has been long and diverse. In a book exploring 10,000 years of interaction, Anton Ervynck and Peter Rowley-Conwy argue that pigs have been central to complex cultural developments in human societies and they played an important role in human migration patterns. The book is firmly grounded within the disciplines of zoology, anthropology and archaeology and contributes to an understanding of the complex and changing relationship humans have historically shared with wild boar and domestic pigs. Naturalist Lyall Watson also explores human/pig relationships in The Whole Hog. The insights these approaches offer for the discipline of history are valuable (although overlooked) but, more importantly, such scholarship also challenges a humanist perspective that credits humans exclusively with historical change and suggests, moreover, that we did it alone. Pigs occupy a special place in this history because of their likeness to humans, revealed in their use in transplant technology, as well as because of the iconic and paradoxical status they occupy in our lives. As Ervynck and Rowley-Conwy explain, “On the one hand, they are praised for their fecundity, their intelligence, and their ability to eat almost anything, but on the other hand, they are unfairly derided for their apparent slovenliness, unclean ways, and gluttonous behaviour” (1). Scientist Niamh O’Connell was struck by the human parallels in the complex social structures which rule the lives of pigs and people when she began a research project on pig behaviour at the Agricultural Research Institute at Hillsborough in County Down (Cassidy). According to O’Connell, pigs adopt different philosophies and lifestyle strategies to get the most out of their life. “What is interesting from a human perspective is that low-ranking animals tend to adopt one of two strategies,” she says. “You have got the animals who accept their station in life and then you have got the other ones that are continually trying to climb, and as a consequence, their life is very stressed” (qtd. in Cassidy). The closeness of pigs to humans is the justification for their use in numerous experiments. In the so-called ‘pig test’, code named ‘Priscilla’, for instance, over 700 pigs dressed in military uniforms were used to study the effects of nuclear testing at the Nevada (USA) test site in the 1950s. In When Species Meet, Donna Haraway draws attention to the ambiguities and contradictions promoted by the divide between animals and humans, and between nature and culture. There is an ethical and critical dimension to this critique of human exceptionalism—the view that “humanity alone is not [connected to the] spatial and temporal web of interspecies dependencies” (11). There is also that danger that any examination of our interdependencies may just satisfy a humanist preoccupation with self-reflection and self-reproduction. Given that pigs cannot speak, will they just become the raw material to reproduce the world in human’s own image? As Haraway explains: “Productionism is about man the tool-maker and -user, whose highest technical production is himself […] Blinded by the sun, in thrall to the father, reproduced in the sacred image of the same, his rewards is that he is self-born, an auto telic copy. That is the mythos of enlightenment and transcendence” (67). Jared Diamond acknowledges the mutualistic relationship between pigs and humans in Guns, Germs and Steel and the complex co-evolutionary path between humans and domesticated animals but his account is human-centric. Human’s relationships with pigs helped to shape human history and power relations and they spread across the world with human expansion. But questioning their utility as food and their enslavement to this cause was not part of the account. Pigs have no voice in the histories we write of them and so they can appear as passive objects in their own pasts. Traces of their pasts are available in humanity’s use of them in, for example, the sties built for them and the cooking implements used to prepare meals from them. Relics include bones and viruses, DNA sequences and land use patterns. Historians are used to dealing with subjects that cannot speak back, but they have usually left ample evidence of what they have said. In the process of writing, historians attempt to perform the miracle, as Curthoys and Docker have suggested, of restoration; bringing the people and places that existed in the past back to life (7). Writing about pigs should also attempt to bring the animal to life, to understand not just their past but also our own culture. In putting forward the idea of an alternative history that starts with pigs, I am aware of both the limits to such a proposal, and that most people’s only contact with pigs is through the meat they buy at the supermarket. Calls for a ban on intensive pig farming (RSPCA, ABC, AACT) might indeed have shocked people who imagine their dinner comes from the type of family farm featured in the movie Babe. Baby pigs in factory farms would have been killed a long time before the film’s sheep dog show (usually at 3 to 4 months of age). In fact, because baby pigs do grow so fast, 48 different pigs were used to film the role of the central character in Babe. While Babe himself may not have been aware of the relationship pigs generally have to humans, the other animals were very cognisant of their function. People eat pigs, even if they change the name of the form it takes in order to do so:Cat: You know, I probably shouldn’t say this, but I’m not sure if you realize how much the other animals are laughing at you for this sheep dog business. Babe: Why would they do that? Cat: Well, they say that you’ve forgotten that you’re a pig. Isn't that silly? Babe: What do you mean? Cat: You know, why pigs are here. Babe: Why are any of us here? Cat: Well, the cow’s here to be milked, the dogs are here to help the Boss's husband with the sheep, and I’m here to be beautiful and affectionate to the boss. Babe: Yes? Cat: [sighs softly] The fact is that pigs don’t have a purpose, just like ducks don’t have a purpose. Babe: [confused] Uh, I—I don’t, uh ... Cat: Alright, for your own sake, I’ll be blunt. Why do the Bosses keep ducks? To eat them. So why do the Bosses keep a pig? The fact is that animals don’t seem to have a purpose really do have a purpose. The Bosses have to eat. It’s probably the most noble purpose of all, when you come to think about it. Babe: They eat pigs? Cat: Pork, they call it—or bacon. They only call them pigs when they’re alive (Noonan). Babe’s transformation into a working pig to round up the sheep makes him more useful. Ferdinand the duck tried to do the same thing by crowing but was replaced by an alarm clock. This is a common theme in children’s stories, recalling Charlotte’s campaign to praise Wilbur the pig in order to persuade the farmer to let him live in E. B. White’s much loved children’s novel, Charlotte’s Web. Wilbur is “some pig”, “terrific”, “radiant” and “humble”. In 1948, four years before Charlotte’s Web, White had published an essay “Death of a Pig”, in which he fails to save a sick pig that he had bought in order to fatten up and butcher. Babe tried to present an alternative reality from a pig’s perspective, but the little pig was only spared because he was more useful alive than dead. We could all ask the question why are any of us here, but humans do not have to contemplate being eaten to justify their existence. The reputation pigs have for being filthy animals encourages distaste. In another movie, Pulp Fiction, Vincent opts for flavour, but Jules’ denial of pig’s personalities condemns them to insignificance:Vincent: Want some bacon? Jules: No man, I don’t eat pork. Vincent: Are you Jewish? Jules: Nah, I ain’t Jewish, I just don’t dig on swine, that’s all. Vincent: Why not? Jules: Pigs are filthy animals. I don’t eat filthy animals. Vincent: Bacon tastes gooood. Pork chops taste gooood. Jules: Hey, sewer rat may taste like pumpkin pie, but I’d never know ’cause I wouldn’t eat the filthy motherf*cker. Pigs sleep and root in sh*t. That’s a filthy animal. I ain’t eat nothin’ that ain’t got sense enough to disregard its own feces [sic]. Vincent: How about a dog? Dogs eats its own feces. Jules: I don’t eat dog either. Vincent: Yeah, but do you consider a dog to be a filthy animal? Jules: I wouldn’t go so far as to call a dog filthy but they’re definitely dirty. But, a dog’s got personality. Personality goes a long way. Vincent: Ah, so by that rationale, if a pig had a better personality, he would cease to be a filthy animal. Is that true? Jules: Well we’d have to be talkin’ about one charming motherf*ckin’ pig. I mean he’d have to be ten times more charmin’ than that Arnold on Green Acres, you know what I’m sayin’? In the 1960s television show Green Acres, Arnold was an exceptional pig who was allowed to do whatever he wanted. He was talented enough to write his own name and play the piano and his attempts at painting earned him the nickname “Porky Picasso”. These talents reflected values that are appreciated, and so he was. The term “pig” is, however, chiefly used a term of abuse, however, embodying traits we abhor—gluttony, obstinence, squealing, foraging, rooting, wallowing. Making a pig of yourself is rarely honoured. Making a pig of the humanities, however, could be a different story. As a historian I love to forage, although I use white gloves rather than a snout. I have rubbed my face and body on tree trunks in the service of forestry history and when the temperature rises I also enjoy wallowing, rolling from side to side rather than drawing a conclusion. More than this, however, pigs provide a valid means of understanding key historical transitions that define modern society. Significant themes in modern history—production, religion, the body, science, power, the national state, colonialism, gender, consumption, migration, memory—can all be understood through a history of our relationships with pigs. Pigs play an important role in everyday life, but their relationship to the economic, social, political and cultural matters discussed in general history texts—industrialisation, the growth of nation states, colonialism, feminism and so on—are generally ignored. However “natural” this place of pigs may seem, culture and tradition profoundly shape their history and their own contribution to those forces has been largely absent in history. What, then, would the contours of such a history that considered the intermeshing of humans and pigs look like? The intermeshing of pigs in early human history Agricultural economies based on domestic animals began independently in different parts of the world, facilitating increases in population and migration. Evidence for long-term genetic continuity between modern and ancient Chinese domestic pigs has been established by DNA sequences. Larson et al. have made an argument for five additional independent domestications of indigenous wild boar populations: in India, South East Asia and Taiwan, which they use to develop a picture of both pig evolution and the development and spread of early farmers in the Far East. Domestication itself involves transformation into something useful to animals. In the process, humans became transformed. The importance of the Fertile Crescent in human history has been well established. The area is attributed as the site for a series of developments that have defined human history—urbanisation, writing, empires, and civilisation. Those developments have been supported by innovations in food production and animal husbandry. Pig, goats, sheep and cows were all domesticated very early in the Fertile Crescent and remain four of the world’s most important domesticated mammals (Diamond 141). Another study of ancient pig DNA has concluded that the earliest domesticated pigs in Europe, believed to be descended from European wild boar, were introduced from the Middle East. The research, by archaeologists at Durham University, sheds new light on the colonisation of Europe by early farmers, who brought their animals with them. Keith Dobney explains:Many archaeologists believe that farming spread through the diffusion of ideas and cultural exchange, not with the direct migration of people. However, the discovery and analysis of ancient Middle Eastern pig remains across Europe reveals that although cultural exchange did happen, Europe was definitely colonised by Middle Eastern farmers. A combination of rising population and possible climate change in the ‘fertile crescent’, which put pressure on land and resources, made them look for new places to settle, plant their crops and breed their animals and so they rapidly spread west into Europe (ctd in ScienceDaily). Middle Eastern farmers colonised Europe with pigs and in the process transformed human history. Identity as a porcine theme Religious restrictions on the consumption of pigs come from the same area. Such restrictions exist in Jewish dietary laws (Kashrut) and in Muslim dietary laws (Halal). The basis of dietary laws has been the subject of much scholarship (Soler). Economic and health and hygiene factors have been used to explain the development of dietary laws historically. The significance of dietary laws, however, and the importance attached to them can be related to other purposes in defining and expressing religious and cultural identity. Dietary laws and their observance may have been an important factor in sustaining Jewish identity despite the dispersal of Jews in foreign lands since biblical times. In those situations, where a person eats in the home of someone who does not keep kosher, the lack of knowledge about your host’s ingredients and the food preparation techniques make it very difficult to keep kosher. Dietary laws require a certain amount of discipline and self-control, and the ability to make distinctions between right and wrong, good and evil, pure and defiled, the sacred and the profane, in everyday life, thus elevating eating into a religious act. Alternatively, people who eat anything are often subject to moral judgments that may also lead to social stigmatisation and discrimination. One of the most powerful and persuasive discourses influencing current thinking about health and bodies is the construction of an ‘obesity epidemic’, critiqued by a range of authors (see for example, Wright & Harwood). As omnivores who appear indiscriminate when it comes to food, pigs provide an image of uncontrolled eating, made visible by the body as a “virtual confessor”, to use Elizabeth Grosz’s term. In Fat Pig, a production by the Sydney Theatre Company in 2006, women are reduced to being either fat pigs or shrieking shallow women. Fatuosity, a blog by PhD student Jackie Wykes drawing on her research on fat and sexual subjectivity, provides a review of the play to describe the misogyny involved: “It leaves no options for women—you can either be a lovely person but a fat pig who will end up alone; or you can be a shrill bitch but beautiful, and end up with an equally obnoxious and shallow male counterpart”. The elision of the divide between women and pigs enacted by such imagery also creates openings for new modes of analysis and new practices of intervention that further challenge humanist histories. Such interventions need to make visible other power relations embedded in assumptions about identity politics. Following the lead of feminists and postcolonial theorists who have challenged the binary oppositions central to western ideology and hierarchical power relations, critical animal theorists have also called into question the essentialist and dualist assumptions underpinning our views of animals (Best). A pig history of the humanities might restore the central role that pigs have played in human history and evolution, beyond their exploitation as food. Humans have constructed their story of the nature of pigs to suit themselves in terms that are specieist, racist, patriarchal and colonialist, and failed to grasp the connections between the oppression of humans and other animals. The past and the ways it is constructed through history reflect and shape contemporary conditions. In this sense, the past has a powerful impact on the present, and the way this is re-told, therefore, also needs to be situated, historicised and problematicised. The examination of history and society from the standpoint of (nonhuman) animals offers new insights on our relationships in the past, but it might also provide an alternative history that restores their agency and contributes to a different kind of future. As the editor of Critical Animals Studies, Steve Best describes it: “This approach, as I define it, considers the interaction between human and nonhuman animals—past, present, and future—and the need for profound changes in the way humans define themselves and relate to other sentient species and to the natural world as a whole.” References ABC. “Changes to Pig Farming Proposed.” ABC News Online 22 May 2010. 10 Aug. 2010 http://www.abc.net.au/news/stories/2010/05/22/2906519.htm Against Animal Cruelty Tasmania. “Australia’s Intensive Pig Industry: The Intensive Pig Industry in Australia Has Much to Hide.” 10 Sep. 2010 http://www.aact.org.au/pig_industry.htm Babe. Dir. Chris Noonan. Universal Pictures, 1995. Best, Steven. “The Rise of Critical Animal Studies: Putting Theory into Action and Animal Liberation into Higher Education.” Journal for Critical Animal Studies 7.1 (2009): 9-53. Cassidy, Martin. “How Close are Pushy Pigs to Humans?”. BBC News Online 2005. 10 Sep. 2010 http://news.bbc.co.uk/2/hi/uk_news/northern_ireland/4482674.stmCurthoys, A., and Docker, J. “Time Eternity, Truth, and Death: History as Allegory.” Humanities Research 1 (1999) 10 Sep. 2010 http://www.anu.edu.au/hrc/publications/hr/hr_1_1999.phpDiamond, Jared. Guns, Germs and Steel: The Fates of Human Societies. New York: W. W. Norton, 1999. Dolader, Miguel-Àngel Motis. “Mediterranean Jewish Diet and Traditions in the Middle Ages”. Food: A Culinary History. Eds. Jean-Louis Flandrin and Massimo Montanari. Trans. Clarissa Botsford, Arthus Golhammer, Charles Lambert, Frances M. López-Morillas and Sylvia Stevens. New York: Columbia UP, 1999. 224-44. Durham University. “Chinese Pigs ‘Direct Descendants’ of First Domesticated Breeds.” ScienceDaily 20 Apr. 2010. 29 Aug. 2010 http://www.sciencedaily.com/releases/2010/04/100419150947.htm Gabaccia, Donna R. We Are What We Eat: Ethnic Food and the Making of Americans. Cambridge: Harvard University Press, 1998. Grosz, Elizabeth. Volatile Bodies: Toward a Corporeal Feminism. St Leonards: Allen & Unwin, 1994. Haraway, D. “The Promises of Monsters: A Regenerative Politics for Inappropriate/d Others.” The Haraway Reader. New York: Routledge, 2005. 63-124. Haraway, D. When Species Meet: Posthumanities. 3rd ed. London: University of Minnesota Press, 2008. Henderson, Fergus. Nose to Tail Eating: A Kind of British Cooking. London: Bloomsbury, 2004. Kiple, Kenneth F., Kriemhild Coneè Ornelas. Cambridge History of Food. Cambridge: Cambridge University Press, 2000. Larson, G., Ranran Liu, Xingbo Zhao, Jing Yuan, Dorian Fuller, Loukas Barton, Keith Dobney, Qipeng Fan, Zhiliang Gu, Xiao-Hui Liu, Yunbing Luo, Peng Lv, Leif Andersson, and Ning Li. “Patterns of East Asian Pig Domestication, Migration, and Turnover Revealed by Modern and Ancient DNA.” Proceedings of the National Academy of Sciences, United States 19 Apr. 2010. 10 Sep. 2010 http://www.pnas.org/cgi/content/full/0912264107/DCSupplemental Meindertsma, Christien. “PIG 05049. Kunsthal in Rotterdam.” 2008. 10 Sep. 2010 http://www.christienmeindertsma.com/index.php?/books/pig-05049Naess, A. “The Shallow and the Deep, Long-Range Ecology Movement.” Inquiry 16 (1973): 95-100. Needman, T. Fat Pig. Sydney Theatre Company. Oct. 2006. Noonan, Chris [director]. “Babe (1995) Memorable Quotes”. 10 Sep. 2010 http://www.imdb.com/title/tt0112431/quotes Plumwood, V. Feminism and the Mastery of Nature. London: Routledge, 1993. Pulp Fiction. Dir. Quentin Tarantino. Miramax, 1994. RSPCA Tasmania. “RSPCA Calls for Ban on Intensive Pig Farming.” 10 Sep. 2010 http://www.rspcatas.org.au/press-centre/rspca-calls-for-a-ban-on-intensive-pig-farming ScienceDaily. “Ancient Pig DNA Study Sheds New Light on Colonization of Europe by Early Farmers” 4 Sep. 2007. 10 Sep. 2010 http://www.sciencedaily.com/releases/2007/09/070903204822.htm Singer, Peter. “Down on the Family Farm ... or What Happened to Your Dinner When it was Still an Animal.” Animal Liberation 2nd ed. London: Jonathan Cape, 1990. 95-158. Soler, Jean. “Biblical Reasons: The Dietary Rules of the Ancient Hebrews.” Food: A Culinary History. Eds. Jean-Louis Flandrin and Massimo Montanari. Trans. Clarissa Botsford, Arthus Golhammer, Charles Lambert, Frances M. López-Morillas and Sylvia Stevens. New York: Columbia University Press, 1999. 46-54. Watson, Lyall. The Whole Hog: Exploring the Extraordinary Potential of Pigs. London: Profile, 2004. White, E. B. Essays of E. B. White. London: HarperCollins, 1979. White, E. B. Charlotte’s Web. London: HarperCollins, 2004. Wright, J., and V. Harwood. Eds. Biopolitics and the ‘Obesity Epidemic’. New York: Routledge, 2009. Wykes, J. Fatuosity 2010. 29 Aug. 2010 http://www.fatuosity.net

40

Haller, Beth. "Switched at Birth: A Game Changer for All Audiences." M/C Journal 20, no.3 (June21, 2017). http://dx.doi.org/10.5204/mcj.1266.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The American Broadcasting Company (ABC) Family Network show Switched at Birth tells two stories—one which follows the unique plot of the show, and one about the new openness of television executives toward integrating more people with a variety of visible and invisible physical embodiments, such as hearing loss, into television content. It first aired in 2011 and in 2017 aired its fifth and final season.The show focuses on two teen girls in Kansas City who find out they were switched due to a hospital error on the day of their birth and who grew up with parents who were not biologically related to them. One, Bay Kennish (Vanessa Marano), lives with her wealthy parents—a stay-at-home mom Kathryn (Lea Thompson) and a former professional baseball player, now businessman, father John (D.W. Moffett). She has an older brother Toby (Lucas Grabeel) who is into music. In her high school science class, Bay learns about blood types and discovers her parents’ blood types could not have produced her. The family has professional genetic tests done and discovers the switch (ABC Family, “This Is Not a Pipe”).In the pilot episode, Bay’s parents find out that deaf teen, Daphne Vasquez (Katie Leclerc), is actually their daughter. She lives in a working class Hispanic neighbourhood with her hairdresser single mother Regina (Constance Marie) and grandmother Adrianna (Ivonne Coll), both of whom are of Puerto Rican ancestry. Daphne is deaf due to a case of meningitis when she was three, which the rich Kennishes feel happened because of inadequate healthcare provided by working class Regina. Daphne attends an all-deaf school, Carlton.The man who was thought to be her biological father, Angelo Sorrento (Gilles Marini), doesn’t appear in the show until episode 10 but becomes a series regular in season 2. It becomes apparent that Daphne believes her father left because of her deafness; however, as the first season progresses, the real reasons begin to emerge. From the pilot onwards, the show dives into clashes of language, culture, ethnicity, class, and even physical appearance—in one scene in the pilot, the waspy Kennishes ask Regina if she is “Mexican.” As later episodes reveal, many of these physical appearance issues are revealed to have fractured the Vasquez family early on—Daphne is a freckled, strawberry blonde, and her father (who is French and Italian) suspected infidelity.The two families merge when the Kennishes ask Daphne and her mother to move into their guest house in order get to know their daughter better. That forces the Kennishes into the world of deafness, and throughout the show this hearing family therefore becomes a surrogate for a hearing audience’s immersion into Deaf culture.Cultural Inclusivity: The Way ForwardShow creator Lizzy Weiss explained that it was actually the ABC Family network that “suggested making one of the kids disabled” (Academy of Television Arts & Sciences). Weiss was familiar with American Sign Language (ASL) because she had a “classical theatre of the Deaf” course in college. She said, “I had in the back of my head a little bit of background at least about how beautiful the language was. So I said, ‘What if one of the girls is deaf?’” The network thought it was wonderful idea, so she began researching the Deaf community, including spending time at a deaf high school in Los Angeles called Marlton, on which she modelled the Switched at Birth school, Carlton. Weiss (Academy of Television Arts & Sciences) says of the school visit experience:I learned so much that day and spoke to dozens of deaf teenagers about their lives and their experiences. And so, this is, of course, in the middle of writing the pilot, and I said to the network, you know, deaf kids wouldn’t voice orally. We would have to have those scenes only in ASL, and no sound and they said, ‘Great. Let’s do it.’ And frankly, we just kind of grew and grew from there.To accommodate the narrative structure of a television drama, Weiss said it became clear from the beginning that the show would need to use SimCom (simultaneous communication or sign supported speech) for the hearing or deaf characters who were signing so they could speak and sign at the same time. She knew this wasn’t the norm for two actual people communicating in ASL, but the production team worried about having a show that was heavily captioned as this might distance its key—overwhelmingly hearing—teen audience who would have to pay attention to the screen during captioned scenes. However, this did not appear to be the case—instead, viewers were drawn to the show because of its unique sign language-influenced television narrative structure. The show became popular very quickly and, with 3.3 million viewers, became the highest-rated premiere ever on the ABC Family network (Barney).Switched at Birth also received much praise from the media for allowing its deaf actors to communicate using sign language. The Huffington Post television critic Maureen Ryan said, “Allowing deaf characters to talk to each other directly—without a hearing person or a translator present—is a savvy strategy that allows the show to dig deeper into deaf culture and also to treat deaf characters as it would anyone else”. Importantly, it allowed the show to be unique in a way that was found nowhere else on television. “It’s practically avant-garde for television, despite the conventional teen-soap look of the show,” said Ryan.Usually a show’s success is garnered by audience numbers and media critique—by this measure Switched at Birth was a hit. However, programs that portray a disability—in any form—are often the target of criticism, particularly from the communities they attempting to represent. It should be noted that, while actress Katie Leclerc, who plays Daphne, has a condition, Meniere’s disease, which causes hearing loss and vertigo on an intermittent basis, she does not identify as a deaf actress and must use a deaf accent to portray Daphne. However, she is ASL fluent, learning it in high school (Orangejack). This meant her qualifications met the original casting call which said “actress must be deaf or hard of hearing and must speak English well, American Sign Language preferred” (Paz, 2010) Leclerc likens her role to that of any actor to who has to affect body and vocal changes for a role—she gives the example of Hugh Laurie in House, who is British with no limp, but was an American who uses a cane in that show (Bibel).As such, initially, some in the Deaf community complained about her casting though an online petition with 140 signatures (Nielson). Yet many in the Deaf community softened any criticism of the show when they saw the production’s ongoing attention to Deaf cultural details (Grushkin). Finally, any lingering criticisms from the Deaf community were quieted by the many deaf actors hired for the show who perform using ASL. This includes Sean Berdy, who plays Daphne’s best friend Emmett, his onscreen mother, played by actress Marlee Matlin, and Anthony Natale who plays his father; their characters both sign and vocalize in the show. The Emmett character only communicates in ASL and does not vocalise until he falls in love with the hearing character Bay—even then he rarely uses his voice.This seemingly all-round “acceptance” of the show gave the production team more freedom to be innovative—by season 3 the audience was deemed to be so comfortable with captions that the shows began to feature less SimCom and more all-captioned scenes. This lead to the full episode in ASL, a first on American mainstream television.For an Hour, Welcome to Our WorldSwitched at Birth writer Chad Fiveash explained that when the production team came up with the idea for a captioned all-ASL episode, they “didn’t want to do the ASL episode as a gimmick. It needed to be thematically resonant”. As a result, they decided to link the episode to the most significant event in American Deaf history, an event that solidified its status as a cultural community—the 1988 Deaf President Now (DPN) protest at Gallaudet University in Washington. This protest inspired the March 2013 episode for Switched at Birth and aired 25 years to the week that the actual DPN protest happened. This episode makes it clear the show is trying to completely embrace Deaf culture and wants its audience to better understand Deaf identity.DPN was a pivotal moment for Deaf people—it truly solidified members of a global Deaf community who felt more empowered to fight for their rights. Students demanded that Gallaudet—as the premier university for deaf and hard-of-hearing students—no longer have a hearing person as its president. The Gallaudet board of trustees, the majority of whom were hearing, tried to force students and faculty to accept a hearing president; their attitude was that they knew what was best for the deaf persons there. For eight days, deaf people across America and the world rallied around the student protestors, refusing to give in until a deaf president was appointed. Their success came in the form of I. King Jordan, a deaf man who had served as dean of the College of Arts & Sciences at the time of the protest.The event was covered by media around the world, giving the American Deaf community international attention. Indeed, Gallaudet University says the DPN protest symbolized more than just the hiring of a Deaf president; it brought Deaf issues before the public and “raised the nation’s consciousness of the rights and abilities of deaf and hard of hearing people” (Gallaudet University).The activities of the students and their supporters showed dramatically that in the 1980s deaf people could be galvanized to unite around a common issue, particularly one of great symbolic meaning, such as the Gallaudet presidency. Gallaudet University represents the pinnacle of education for deaf people, not only in the United States but throughout the world. The assumption of its presidency by a person himself deaf announced to the world that deaf Americans were now a mature minority (Van Cleve and Crouch, 172).Deaf people were throwing off the oppression of the hearing world by demanding that their university have someone from their community at its helm. Jankowski (Deaf Empowerment; A Metaphorical Analysis of Conflict) studied the Gallaudet protest within the framework of a metaphor. She found a recurring theme during the DPN protest to be Gallaudet as “plantation”—which metaphorically refers to deaf persons as slaves trying to break free from the grip of the dominant mastery of the hearing world—and she parallels the civil rights movement of African Americans in the 1960s. As an example, Gallaudet was referred to as the “Selma of the Deaf” during the protest, and protest signs used the language of Martin Luther King such as “we still have a dream.” For deaf Americans, the presidency of Gallaudet became a symbol of hope for the future. As Jankowski attests:deaf people perceived themselves as possessing the ability to manage their own kind, pointing to black-managed organization, women-managed organizations, etc., struggling for that same right. They argued that it was a fight for their basic human rights, a struggle to free themselves, to release the hold their ‘masters’ held on them. (“A Metaphorical Analysis”)The creators of the Switched at Birth episode wanted to ensure of these emotions, as well as historical and cultural references, were prevalent in the modern-day, all-ASL episode, titled Uprising. That show therefore wanted to represent both the 1988 DPN protest as well as a current issue in the US—the closing of deaf schools (Anderson). The storyline focuses on the deaf students at the fictitious Carlton School for the Deaf seizing one of the school buildings to stage a protest because the school board has decided to shut down the school and mainstream the deaf students into hearing schools. When the deaf students try to come up with a list of demands, conflicts arise about what the demands should be and whether a pilot program—allowing hearing kids who sign to attend the deaf school—should remain.This show accomplished multiple things with its reach into Deaf history and identity, but it also did something technologically unique for the modern world—it made people pay attention. Because captioning translated the sign language for viewers, Lizzy Weiss, the creator of the series, said, “Every single viewer—deaf or hearing—was forced to put away their phones and iPads and anything else distracting … and focus … you had to read … you couldn’t do anything else. And that made you get into it more. It drew you in” (Stelter). The point, Weiss said, “was about revealing something new to the viewer—what does it feel like to be an outsider? What does it feel like to have to read and focus for an entire episode, like deaf viewers do all the time?” (Stelter). As one deaf reviewer of the Uprising episode said, “For an hour, welcome to our world! A world that’s inconvenient, but one most of us wouldn’t leave if offered a magic pill” (DR_Staff).This episode, more than any other, afforded hearing television viewers an experience perhaps similar to deaf viewers. The New York Times reported that “Deaf and hard-of-hearing viewers commented by the thousands after the show, with many saying in effect, “Yes! That’s what it feels like” (Stelter).Continued ResonancesWhat is also unique about the episode is that in teaching the hearing viewers more about the Deaf community, it also reinforced Deaf community pride and even taught young deaf people a bit of their own history. The Deaf community and Gallaudet were very pleased with their history showing up on a television show—the university produced a 30-second commercial which aired within the episode, and held viewing parties. Gallaudet also forwarded the 35 pages of Facebook comments they’d received about the episode to ABC Family and Gallaudet President T. Alan Hurwitz said of the episode (Yahr), “Over the past 25 years, [DPN] has symbolised self-determination and empowerment for deaf and hard of hearing people around the world”. The National Association of the Deaf (NAD) also lauded the episode, describing it as “phenomenal and groundbreaking, saying the situation is very real to us” (Stelter)—NAD had been vocally against budget cuts and closings of US deaf schools.Deaf individuals all over the Internet and social media also spoke out about the episode, with overwhelmingly favourable opinions. Deaf blogger Amy Cohen Efron, who participated in 1988′s DPN movement, said that DPN was “a turning point of my life, forcing me to re-examine my own personal identity, and develop self-determinism as a Deaf person” and led to her becoming an activist.When she watched the Uprising episode, she said the symbolic and historical representations in the show resonated with her. In the episode, a huge sign is unfurled on the side of the Carlton School for the Deaf with a girl with a fist in the air under the slogan “Take Back Carlton.” During the DPN protest, the deaf student protesters unfurled a sign that said “Deaf President Now” with the US Capitol in the background; this image has become an iconic symbol of modern Deaf culture. Efron says the image in the television episode was much more militant than the actual DPN sign. However, it could be argued that society now sees the Deaf community as much more militant because of the DPN protest, and that the imagery in the Uprising episode played into that connection. Efron also acknowledged the episode’s strong nod to the Gallaudet student protestors who defied the hearing community’s expectations by practising civil disobedience. As Efron explained, “Society expected that the Deaf people are submissive and accept to whatever decision done by the majority without any of our input and/or participation in the process.”She also argues that the episode educated more than just the hearing community. In addition to DPN, Uprising was filled with other references to Deaf history. For example a glass door to the room at Carlton was covered with posters about people like Helen Keller and Jean-Ferdinand Berthier, a deaf educator in 19th century France who promoted the concept of deaf identity and culture—Efron says most people in the Deaf community have never heard of him. She also claims that the younger Deaf community may also not be aware of the 1988 DPN protest—“It was not in high school textbooks available for students. Many deaf and hard of hearing students are mainstreamed and they have not the slightest idea about the DPN movement, even about the Deaf Community’s ongoing fight against discrimination, prejudice and oppression, along with our victories”.Long before the Uprising episode aired, the Deaf community had been watching Switched at Birth carefully to make sure Deaf culture was accurately represented. Throughout season 3 David Martin created weekly videos in sign language that were an ASL/Deaf cultural analysis of Switched at Birth. He highlighted content he liked and signs that were incorrect, a kind of a Deaf culture/ASL fact checker. From the Uprising episode, he said he thought this quote from Marlee Matlin’s character said it all, “Until hearing people walk a day in our shoes they will never understand” (Martin). That succinctly states what the all-ASL episode was trying to capture—creating an awareness of Deaf people’s cultural experience and their oppression in hearing society.Even a deaf person who was an early critic of Switched at Birth because of the hiring of Katie Leclerc and the use of SimCom admitted he was impressed with the all-ASL episode (Grushkin):all too often, we see media accounts of Deaf people which play into our society’s perceptions of Deaf people: as helpless, handicapped individuals who are in need of fixes such as cochlear implants in order to “restore” us to society. Almost never do we see accounts of Deaf people as healthy, capable individuals who live ordinary, successful lives without necessarily conforming to the Hearing ‘script’ for how we should be. And important issues such as language rights or school closings are too often virtually ignored by the general media.In addition to the episode being widely discussed within the Deaf community, the mainstream news media also covered Uprising intensely, seeing it as a meaningful cultural moment, not just for the Deaf community but for popular culture in general. Lacob wrote that he realises that hearing viewers probably won’t understand what it means to be a deaf person in modern America, but he believes that the episodeposits that there are moments of understanding, commonalities, and potential bridge-building between these two communities. And the desire for understanding is the first step toward a more inclusive and broad-minded future.He continues:the significance of this moment can’t be undervalued, nor can the show’s rich embrace of deaf history, manifested here in the form of Gallaudet and the historical figures whose photographs and stories are papered on the windows of Carlton during the student protest. What we’re seeing on screen—within the confines of a teen drama, no less—is an engaged exploration of a culture and a civil rights movement brought to life with all of the color and passion it deserves. It may be 25 years since Gallaudet, but the dreams of those protesters haven’t faded. And they—and the ideals of identity and equality that they express—are most definitely being heard.Lacob’s analysis was praised by several Deaf people—by a Deaf graduate student who teaches a Disability in Popular Culture course and by a Gallaudet student who said, “From someone who is deaf, and not ashamed of it either, let me say right here and now: that was the most eloquent piece of writing by someone hearing I have ever seen” (Emma72). The power of the Uprising episode illustrated a political space where “groups actively fuse and blend their culture with the mainstream culture” (Foley 119, as cited in Chang 3). Switched at Birth—specifically the Uprising episode—has indeed fused Deaf culture and ASL into a place in mainstream television culture.ReferencesABC Family. “Switched at Birth Deaf Actor Search.” Facebook (2010). <https://www.facebook.com/SwitchedSearch>.———. “This Is Not a Pipe.” Switched at Birth. Pilot episode. 6 June 2011. <http://freeform.go.com/shows/switched-at-birth>.———. “Not Hearing Loss, Deaf Gain.” Switched at Birth. YouTube video, 11 Feb. 2013. <https://www.youtube.com/watch?v=F5W604uSkrk>.Academy of Television Arts & Sciences. “Talking Diversity: ABC Family’s Switched at Birth.” Emmys.com (Feb. 2012). <http://www.emmys.com/content/webcast-talking-diversity-abc-familys-switched-birth>.Anderson, G. “‘Switched at Birth’ Celebrates 25th Anniversary of ‘Deaf President Now’.” Pop-topia (5 Mar. 2013). <http://www.pop-topia.com/switched-at-birth-celebrates-25th-anniversary-of-deaf-president-now/>.Barney, C. “’Switched at Birth’ Another Winner for ABC Family.” Contra Costa News (29 June 2011). <http://www.mercurynews.com/tv/ci_18369762>.Bibel, S. “‘Switched at Birth’s Katie LeClerc Is Proud to Represent the Deaf Community.” Xfinity TV blog (20 June 2011). <http://xfinity.comcast.net/blogs/tv/2011/06/20/switched-at-births-katie-leclerc-is-proud-to-represent-the-deaf-community/>.Chang, H. “Re-Examining the Rhetoric of the ‘Cultural Border’.” Essay presented at the American Anthropological Association Annual Meeting, Philadelphia, Dec. 1988.DR_Staff. “Switched at Birth: How #TakeBackCarlton Made History.” deafReview (6 Mar. 2013). <http://deafreview.com/deafreview-news/switched-at-birth-how-takebackcarlton-made-history/>.Efron, Amy Cohen. “Switched At Birth: Uprising – Deaf Adult’s Commentary.” Deaf World as I See It (Mar. 2013). <http://www.deafeyeseeit.com/2013/03/05/sabcommentary/>.Emma72. “ABC Family’s ‘Switched at Birth’ ASL Episode Recalls Gallaudet Protest.” Comment. The Daily Beast (28 Feb. 2013). <http://www.thedailybeast.com/articles/2013/02/28/abc-family-s-switched-at-birth-asl-episode-recalls-gallaudet-protest.html>.Fiveash, Chad. Personal interview. 17 Jan. 2014.Gallaudet University. “The Issues.” Deaf President Now (2013). <http://www.gallaudet.edu/dpn_home/issues.html>.Grushkin, D. “A Cultural Review. ASL Challenged.” Switched at Birth Facebook page. Facebook (2013). <https://www.facebook.com/SwitchedatBirth/posts/508748905835658>.Jankowski, K.A. Deaf Empowerment: Emergence, Struggle, and Rhetoric. Washington: Gallaudet UP, 1997.———. “A Metaphorical Analysis of Conflict at the Gallaudet Protest.” Unpublished seminar paper presented at the University of Maryland, 1990.Lacob, J. “ABC Family’s ‘Switched at Birth’ ASL Episode Recalls Gallaudet Protest.” The Daily Beast 28 Feb. 2013. <http://www.thedailybeast.com/articles/2013/02/28/abc-family-s-switched-at-birth-asl-episode-recalls-gallaudet-protest.html>.Martin, D. “Switched at Birth Season 2 Episode 9 ‘Uprising’ ASL/Deaf Cultural Analysis.” David Martin YouTube channel (6 Mar. 2013). <http://www.youtube.com/watch?v=JA0vqCysoVU>.Nielson, R. “Petitioned ABC Family and the ‘Switched at Birth’ Series, Create Responsible, Accurate, and Family-Oriented TV Programming.” Change.org (2011). <http://www.change.org/p/abc-family-and-the-switched-at-birth-series-create-responsible-accurate-and-family-oriented-tv-programming>.Orangejack. “Details about Katie Leclerc’s Hearing Loss.” My ASL Journey Blog (29 June 2011). <http://asl.orangejack.com/details-about-katie-leclercs-hearing-loss>.Paz, G. “Casting Call: Open Auditions for Switched at Birth by ABC Family.” Series & TV (3 Oct. 2010). <http://seriesandtv.com/casting-call-open-auditions-for-switched-at-birth-by-abc-family/4034>.Ryan, Maureen. “‘Switched at Birth’ Season 1.5 Has More Drama and Subversive Soapiness.” The Huffington Post (31 Aug. 2012). <http://www.huffingtonpost.com/maureen-ryan/switched-at-birth-season-1_b_1844957.html>.Stelter, B. “Teaching Viewers to Hear with Their Eyes Only.” The New York Times 8 Mar. 2013. <http://www.nytimes.com/2013/03/09/arts/television/teaching-viewers-to-hear-the-tv-with-eyes-only.html>.Van Cleve, J.V., and B.A. Crouch. A Place of Their Own: Creating the Deaf Community in America. DC: Gallaudet University Press, 1989.Yahr, E. “Gallaudet University Uses All-Sign Language Episode of ‘Switched at Birth’ to Air New Commercial.” The Washington Post 3 Mar. 2013 <http://www.washingtonpost.com/blogs/tv-column/post/gallaudet-university-uses-all-sign-language-episode-of-switched-at-birth-to-air-new-commercial/2013/03/04/0017a45a-8508-11e2-9d71-f0feafdd1394_blog.html>.

41

Pugsley, Peter. "At Home in Singaporean Sitcoms." M/C Journal 10, no.4 (August1, 2007). http://dx.doi.org/10.5204/mcj.2695.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The use of the family home as a setting for television sitcoms (situation comedies) has long been recognised for its ability to provide audiences with an identifiable site of ontological security (much discussed by Giddens, Scannell, Saunders and others). From the beginnings of American sitcoms with such programs as Leave it to Beaver, and through the trail of The Brady Bunch, The Cosby Show, Roseanne, The Fresh Prince of Bel Air, and on to Home Improvement, That 70s Show and How I Met Your Mother, the US has led the way with screenwriters and producers capitalising on the value of using the suburban family dwelling as a fixed setting. The most obvious advantage is the use of an easily constructed and inexpensive set, most often on a TV studio soundstage requiring only a few rooms (living room, kitchen and bedroom are usually enough to set the scene), and a studio audience. In Singapore, sitcoms have had similar successes; portraying the lives of ‘ordinary people’ in their home settings. Some programs have achieved phenomenal success, including an unprecedented ten year run for Phua Chu Kang Pte Ltd from 1996-2007, closely followed by Under One Roof (1994-2000 and an encore season in 2002), and Living with Lydia (2001-2005). This article furthers Blunt and Dowling’s exploration of the “critical geography” of home, by providing a focused analysis of home-based sitcoms in the nation-state of Singapore. The use of the home tells us a lot. Roseanne’s cluttered family home represents a lived reality for working-class families throughout the Western world. In Friends, the seemingly wealthy ‘young’ people live in a fashionable apartment building, while Seinfeld’s apartment block is much less salubrious, indicating (in line with the character) the struggle of the humble comedian. Each of these examples tells us something about not just the characters, but quite often about class, race, and contemporary societies. In the Singaporean programs, the home in Under One Roof (hereafter UOR) represents the major form of housing in Singapore, and the program as a whole demonstrates the workability of Singaporean multiculturalism in a large apartment block. Phua Chu Kang Pte Ltd (PCK) demonstrates the entrepreneurial abilities of even under-educated Singaporeans, with its lead character, a building contractor, living in a large freestanding dwelling – generally reserved for the well-heeled of Singaporean society. And in Living with Lydia (LWL) (a program which demonstrates Singapore’s capacity for global integration), Hong Kong émigré Lydia is forced to share a house (less ostentatious than PCK’s) with the family of the hapless Billy B. Ong. There is perhaps no more telling cultural event than the sitcom. In the 1970s, The Brady Bunch told us more about American values and habits than any number of news reports or cop shows. A nation’s identity is uncovered; it bares its soul to us through the daily tribulations of its TV households. In Singapore, home-based sitcoms have been one of the major success stories in local television production with each of these three programs collecting multiple prizes at the region-wide Asian Television Awards. These sitcoms have been able to reflect the ideals and values of the Singaporean nation to audiences both at ‘home’ and abroad. This article explores the worlds of UOR, PCK, and LWL, and the ways in which each of the fictional homes represents key features of the multi-ethnic, multi-cultural Singapore. Through ownership and regulation, Singaporean TV programs operate as a firm link between the state and its citizens. These sitcoms follow regular patterns where the ‘man of the house’ is more buffoon than breadwinner – in a country defined by its neo-Confucian morality, sitcoms allow a temporary subversion of patriarchal structures. In this article I argue that the central theme in Singaporean sitcoms is that while home is a personal space, it is also a valuable site for national identities to be played out. These identities are visible in the physical indicators of the exterior and interior living spaces, and the social indicators representing a benign patriarchy and a dominant English language. Structure One of the key features of sitcoms is the structure: cold open – titles – establishing shot – opening scene. Generally the cold opening (aka “the teaser”) takes place inside the home to quickly (re)establish audience familiarity with the location and the characters. The title sequence then features, in the case of LWL and PCK, the characters outside the house (in LWL this is in cartoon format), and in UOR (see Figure 1) it is the communal space of the barbeque area fronting the multi-story HDB (Housing Development Board) apartment blocks. Figure 1: Under One Roof The establishing shot at the end of each title sequence, and when returning from ad breaks, is an external view of the characters’ respective dwellings. In Seinfeld this establishing shot is the New York apartment block, in Roseanne it is the suburban house, and the Singaporean sitcoms follow the same format (see Figure 2). Figure 2: Phua Chu Kang External Visions of the Home This emphasis on exterior buildings reminds the viewer that Singaporean housing is, in many ways, unique. As a city-state (and a young one at that) its spatial constraints are particularly limiting: there simply isn’t room for suburban housing on quarter acre blocks. It rapidly transformed from an “empty rock” to a scattered Malay settlement of bay and riverside kampongs (villages) recognisable by its stilt houses. Then in the shadow of colonialism and the rise of modernity, the kampongs were replaced in many cases by European-inspired terrace houses. Finally, in the post-colonial era high-rise housing began to swell through the territory, creating what came to be known as the “HDB new town”, with some 90% of the population now said to reside in HDB units, and many others living in private high-rises (Chang 102, 104). Exterior shots used in UOR (see Figure 3) consistently emphasise the distinctive HDB blocks. As with the kampong housing, high-rise apartments continue notions of communal living in that “Living below, above and side by side other people requires tolerance of neighbours and a respect towards the environment of the housing estate for the good of all” (104). The provision of readily accessible public housing was part of the “covenant between the newly enfranchised electorate and the elected government” (Chua 47). Figure 3: Establishing shot from UOR In UOR, we see the constant interruption of the lives of the Tan family by their multi-ethnic neighbours. This occurs to such an extent as to be a part of the normal daily flow of life in Singaporean society. Chang argues that despite the normally interventionist activities of the state, it is the “self-enforcing norms” of behaviour that have worked in maintaining a “peaceable society in high-rise housing” (104). This communitarian attitude even extends to the large gated residence of PCK, home to an almost endless stream of relatives and friends. The gate itself seems to perform no restrictive function. But such a “peaceable society” can also be said to be a result of state planning which extends to the “racial majoritarianism” imposed on HDB units in the form of quotas determining “the actual number of households of each of the three major races [Chinese, Malay and Indian] … to be accommodated in a block of flats” (Chua 55). Issues of race are important in Singapore where “the inscription of media imagery bears the cultural discourse and materiality of the social milieu” (Wong 120) perhaps nowhere more graphically illustrated than in the segregation of TV channels along linguistic / cultural lines. These 3 programs all featured on MediaCorp TV’s predominantly English-language Channel 5 and are, in the words of Roland Barthes, “anchored” by dint of their use of English. Home Will Eat Itself The consumption of home-based sitcoms by audiences in their own living-rooms creates a somewhat self-parodying environment. As John Ellis once noted, it is difficult to escape from the notion that “TV is a profoundly domestic phenomenon” (113) in that it constantly attempts to “include the audiences own conception of themselves into the texture of its programmes” (115). In each of the three Singaporean programs living-rooms are designed to seat characters in front of a centrally located TV set – at most all the audience sees is the back of the TV, and generally only when the TV is incorporated into a storyline, as in the case of PCK in Figure 4 (note the TV set in the foreground). Figure 4: PCK Even in this episode of PCK when the lead characters stumble across a p*rnographic video starring one of the other lead characters, the viewer only hears the program. Perhaps the most realistic (and acerbic) view of how TV reorganises our lives – both spatially in the physical layout of our homes, and temporally in the way we construct our viewing habits (eating dinner or doing the housework while watching the screen) – is the British “black comedy”, The Royle Family. David Morley (443) notes that “TV and other media have adapted themselves to the circ*mstances of domestic consumption while the domestic arena itself has been simultaneously redefined to accommodate their requirements”. Morley refers to The Royle Family’s narrative that rests on the idea that “for many people, family life and watching TV have become indistinguishable to the extent that, in this fictional household, it is almost entirely conducted from the sitting positions of the viewers clustered around the set” (436). While TV is a central fixture in most sitcoms, its use is mostly as a peripheral thematic device with characters having their viewing interrupted by the arrival of another character, or by a major (within the realms of the plot) event. There is little to suggest that “television schedules have instigated a significant restructuring of family routines” as shown in Livingstone’s audience-based study of UK viewers (104). In the world of the sitcom, the temporalities of characters’ lives do not need to accurately reflect that of “real life” – or if they do, things quickly descend to the bleakness exemplified by the sedentary Royles. As Scannell notes, “broadcast output, like daily life, is largely uneventful, and both are punctuated (predictably and unpredictably) by eventful occasions” (4). To show sitcom characters in this static, passive environment would be anathema to the “real” viewer, who would quickly lose interest. This is not to suggest that sitcoms are totally benign though as with all genres they are “the outcome of social practices, received procedures that become objectified in the narratives of television, then modified in the interpretive act of viewing” (Taylor 14). In other words, they feature a contextualisation that is readily identifiable to members of an established society. However, within episodes themselves, it as though time stands still – character development is almost non-existent, or extremely slow at best and we see each episode has “flattened past and future into an eternal present in which parents love and respect one another, and their children forever” (Taylor 16). It takes some six seasons before the character of PCK becomes a father, although in previous seasons he acts as a mentor to his nephew, Aloysius. Contained in each episode, in true sitcom style, are particular “narrative lines” in which “one-liners and little comic situations [are] strung on a minimal plot line” containing a minor problem “the solution to which will take 22 minutes and pull us gently through the sequence of events toward a conclusion” (Budd et al. 111). It is important to note that the sitcom genre does not work in every culture, as each locale renders the sitcom with “different cultural meanings” (Nielsen 95). Writing of the failure of the Danish series Three whor*s and a Pickpocket (with a premise like that, how could it fail?), Nielsen (112) attributes its failure to the mixing of “kitchen sink realism” with “moments of absurdity” and “psychological drama with expressionistic camera work”, moving it well beyond the strict mode of address required by the genre. In Australia, soap operas Home and Away and Neighbours have been infinitely more popular than our attempts at sitcoms – which had a brief heyday in the 1980s with Hey Dad..!, Kingswood Country and Mother and Son – although Kath and Kim (not studio-based) could almost be counted. Lichter et al. (11) state that “television entertainment can be ‘political’ even when it does not deal with the stuff of daily headlines or partisan controversy. Its latent politics lie in the unavoidable portrayal of individuals, groups, and institutions as a backdrop to any story that occupies the foreground”. They state that US television of the 1960s was dominated by the “idiot sitcom” and that “To appreciate these comedies you had to believe that social conventions were so ironclad they could not tolerate variations. The scripts assumed that any minute violation of social conventions would lead to a crisis that could be played for comic results” (15). Series like Happy Days “harked back to earlier days when problems were trivial and personal, isolated from the concerns of a larger world” (17). By the late 1980s, Roseanne and Married…With Children had “spawned an antifamily-sitcom format that used sarcasm, cynicism, and real life problems to create a type of in-your-face comedy heretofore unseen on prime time” (20). This is markedly different from the type of values presented in Singaporean sitcoms – where filial piety and an unrelenting faith in the family unit is sacrosanct. In this way, Singaporean sitcoms mirror the ideals of earlier US sitcoms which idealise the “egalitarian family in which parental wisdom lies in appeals to reason and fairness rather than demands for obedience” (Lichter et al. 406). Dahlgren notes that we are the products of “an ongoing process of the shaping and reshaping of identity, in response to the pluralised sets of social forces, cultural currents and personal contexts encountered by individuals” where we end up with “composite identities” (318). Such composite identities make the presentation (or re-presentation) of race problematic for producers of mainstream television. Wong argues that “Within the context of PAP hegemony, media presentation of racial differences are manufactured by invoking and resorting to traditional values, customs and practices serving as symbols and content” (118). All of this is bound within a classificatory system in which each citizen’s identity card is inscribed as Chinese, Malay, Indian or Other (often referred to as CMIO), and a broader social discourse in which “the Chinese are linked to familial values of filial piety and the practice of extended family, the Malays to Islam and rural agricultural activities, and the Indians to the caste system” (Wong 118). However, these sitcoms avoid directly addressing the issue of race, preferring to accentuate cultural differences instead. In UOR the tables are turned when a none-too-subtle dig at the crude nature of mainland Chinese (with gags about the state of public toilets), is soon turned into a more reverential view of Chinese culture and business acumen. Internal Visions of the Home This reverence for Chinese culture is also enacted visually. The loungeroom settings of these three sitcoms all provide examples of the fashioning of the nation through a “ubiquitous semi-visibility” (Noble 59). Not only are the central characters in each of these sitcoms constructed as ethnically Chinese, but the furnishings provide a visible nod to Chinese design in the lacquered screens, chairs and settees of LWL (see Figure 5.1), in the highly visible pair of black inlaid mother-of-pearl wall hangings of UOR (see Figure 5.2) and in the Chinese statuettes and wall-hangings found in the PCK home. Each of these items appears in the central view of the shows most used setting, the lounge/family room. There is often symmetry involved as well; the balanced pearl hangings of UOR are mirrored in a set of silk prints in LWL and the pair of ceramic Chinese lions in PCK. Figure 5.1: LWL Figure 5.2: UOR Thus, all three sitcoms feature design elements that reflect visible links to Chinese culture and sentiments, firmly locating the sitcoms “in Asia”, and providing a sense of the nation. The sets form an important role in constructing a realist environment, one in which “identification with realist narration involves a temporary merger of at least some of the viewer’s identity with the position offered by the text” (Budd et al. 110). These constant silent reminders of the Chinese-based hegemon – the cultural “majoritarianism” – anchors the sitcoms to a determined concept of the nation-state, and reinforces the “imaginative geographies of home” (Blunt and Dowling 247). The Foolish “Father” Figure in a Patriarchal Society But notions of a dominant Chinese culture are dealt with in a variety of ways in these sitcoms – not the least in a playful attitude toward patriarchal figures. In UOR, the Tan family “patriarch” is played by Moses Lim, in PCK, Gurmit Singh plays Phua and in LWL Samuel Chong plays Billy B. Ong (or, as Lydia mistakenly refers to him Billy Bong). Erica Sharrer makes the claim that class is a factor in presenting the father figure as buffoon, and that US sitcoms feature working class families in which “the father is made to look inept, silly, or incompetent have become more frequent” partly in response to changing societal structures where “women are shouldering increasing amounts of financial responsibility in the home” (27). Certainly in the three series looked at here, PCK (the tradesman) is presented as the most derided character in his role as head of the household. Moses Lim’s avuncular Tan Ah Teck is presented mostly as lovably foolish, even when reciting his long-winded moral tales at the conclusion of each episode, and Billy B. Ong, as a middle-class businessman, is presented more as a victim of circ*mstance than as a fool. Sharrer ponders whether “sharing the burden of bread-winning may be associated with fathers perceiving they are losing advantages to which they were traditionally entitled” (35). But is this really a case of males losing the upper hand? Hanke argues that men are commonly portrayed as the target of humour in sitcoms, but only when they “are represented as absurdly incongruous” to the point that “this discursive strategy recuperates patriarchal notions” (90). The other side of the coin is that while the “dominant discursive code of patriarchy might be undone” (but isn’t), “the sitcom’s strategy for containing women as ‘wives’ and ‘mothers’ is always contradictory and open to alternative readings” (Hanke 77). In Singapore’s case though, we often return to images of the women in the kitchen, folding the washing or agonising over the work/family dilemma, part of what Blunt and Dowling refer to as the “reproduction of patriarchal and heterosexist relations” often found in representations of “the ideal’ suburban home” (29). Eradicating Singlish One final aspect of these sitcoms is the use of language. PM Lee Hsien Loong once said that he had no interest in “micromanaging” the lives of Singaporeans (2004). Yet his two predecessors (PM Goh and PM Lee Senior) both reflected desires to do so by openly criticising the influence of Phua Chu Kang’s liberal use of colloquial phrases and phrasing. While the use of Singlish (or Singapore Colloquial English / SCE) in these sitcoms is partly a reflection of everyday life in Singapore, by taking steps to eradicate it through the Speak Good English movement, the government offers an intrusion into the private home-space of Singaporeans (Ho 17). Authorities fear that increased use of Singlish will damage the nation’s ability to communicate on a global basis, withdrawing to a locally circ*mscribed “pidgin English” (Rubdy 345). Indeed, the use of Singlish in UOR is deliberately underplayed in order to capitalise on overseas sales of the show (which aired, for example, on Australia’s SBS television) (Srilal). While many others have debated the Singlish issue, my concern is with its use in the home environment as representative of Singaporean lifestyles. As novelist Hwee Hwee Tan (2000) notes: Singlish is crude precisely because it’s rooted in Singapore’s unglamorous past. This is a nation built from the sweat of uncultured immigrants who arrived 100 years ago to bust their asses in the boisterous port. Our language grew out of the hardships of these ancestors. Singlish thus offers users the opportunity to “show solidarity, comradeship and intimacy (despite differences in background)” and against the state’s determined efforts to adopt the language of its colonizer (Ho 19-20). For this reason, PCK’s use of Singlish iterates a “common man” theme in much the same way as Paul Hogan’s “Ocker” image of previous decades was seen as a unifying feature of mainstream Australian values. That the fictional PCK character was eventually “forced” to take “English” lessons (a storyline rapidly written into the program after the direct criticisms from the various Prime Ministers), is a sign that the state has other ideas about the development of Singaporean society, and what is broadcast en masse into Singaporean homes. Conclusion So what do these home-based sitcoms tell us about Singaporean nationalism? Firstly, within the realms of a multiethnic society, mainstream representations reflect the hegemony present in the social and economic structures of Singapore. Chinese culture is dominant (albeit in an English-speaking environment) and Indian, Malay and Other cultures are secondary. Secondly, the home is a place of ontological security, and partial adornment with cultural ornaments signifying Chinese culture are ever-present as a reminder of the Asianness of the sitcom home, ostensibly reflecting the everyday home of the audience. The concept of home extends beyond the plywood-prop walls of the soundstage though. As Noble points out, “homes articulate domestic spaces to national experience” (54) through the banal nationalism exhibited in “the furniture of everyday life” (55). In a Singaporean context, Velayutham (extending the work of Morley) explores the comforting notion of Singapore as “home” to its citizens and concludes that the “experience of home and belonging amongst Singaporeans is largely framed in the materiality and social modernity of everyday life” (4). Through the use of sitcoms, the state is complicit in creating and recreating the family home as a site for national identities, adhering to dominant modes of culture and language. References Blunt, Alison, and Robyn Dowling. Home. London: Routledge, 2006. Budd, Mike, Steve Craig, and Clay Steinman. Consuming Environments: Television and Commercial Culture. New Jersey: Rutgers UP, 1999. Chang, Sishir. “A High-Rise Vernacular in Singapore’s Housing Development Board Housing.” Berkeley Planning Journal 14 (2000): 97-116. Chua, Beng Huat. “Public Housing Residents as Clients of the State.” Housing Studies 15.1 (2000). Dahlgren, Peter. “Media, Citizenship and Civic Culture”. Mass Media and Society. 3rd ed. Eds. James Curran and Michael Gurevitch. London: Arnold, 2000. 310-328. Ellis, John. Visible Fictions: Cinema, Television, Video. London: Routledge & Kegan Paul, 1982. Hanke, Robert. “The ‘Mock-Macho’ Situation Comedy: Hegemonic Masculinity and its Reiteration.” Western Journal of Communication 62.1 (1998). Ho, Debbie G.E. “‘I’m Not West. I’m Not East. So How Leh?’” English Today 87 22.3 (2006). Lee, Hsien Loong. “Our Future of Opportunity and Promise.” National Day Rally 2004 Speech. 29 Apr. 2007 http://www.gov.sg/nd/ND04.htm>. Lichter, S. Robert, Linda S. Lichter, and Stanley Rothman. Prime Time: How TV Portrays American Culture. Washington D.C.: Regnery Publishing, 1994. Livingstone, Sonia. Young People and New Media: Childhood and the Changing Media Environment. London: Sage, 2002 Morley, David. “What’s ‘Home’ Got to Do with It? Contradictory Dynamics in the Domestication of Technology and the Dislocation of Domesticity.” European Journal of Cultural Studies 6 (2003). Noble, Greg. “Comfortable and Relaxed: Furnishing the Home and Nation.” Continuum: Journal of Media and Cultural Studies 16.1 (2002). Rubdy, Rani. “Creative Destruction: Singapore’s Speak Good English Movement.” World Englishes 20.3 (2001). Scannell, Paddy. “For a Phenomenology of Radio and Television.” Journal of Communication 45.3 (1995). Scharrer, Erica. “From Wise to Foolish: The Portrayal of the Sitcom Father, 1950s-1990s.” Journal of Broadcasting and Electronic Media 45.1 (2001). Srilal, Mohan. “Quick Quick: ‘Singlish’ Is Out in Re-education Campaign.” Asia Times Online (28 Aug. 1999). Tan, Hwee Hwee. “A War of Words over ‘Singlish’: Singapore’s Government Wants Its Citizens to Speak Good English, But They Would Rather Be ‘Talking co*ck’.” Time International 160.3 (29 July 2002). Taylor, Ella. “From the Nelsons to the Huxtables: Genre and Family Imagery in American Network Television.” Qualitative Sociology 12.1 (1989). Velayutham, Selvaraj. “Affect, Materiality, and the Gift of Social Life in Singapore.” SOJOURN 19.1 (2004). Wong, Kokkeong. Media and Culture in Singapore: A Theory of Controlled Commodification. New Jersey: Hampton Press, 2001. Images Under One Roof: The Special Appearances. Singapore: Television Corporation of Singapore. VCD. 2000. Living with Lydia (Season 1, Volume 1). Singapore: MediaCorp Studios, Blue Max Enterprise. VCD. 2001. Phua Chu Kang Pte Ltd (Season 5, Episode 10). Kuala Lumpur: MediaCorp Studios, Speedy Video Distributors. VCD. 2003. Citation reference for this article MLA Style Pugsley, Peter. "At Home in Singaporean Sitcoms: Under One Roof, Living with Lydia and Phua Chu Kang." M/C Journal 10.4 (2007). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0708/09-pugsley.php>. APA Style Pugsley, P. (Aug. 2007) "At Home in Singaporean Sitcoms: Under One Roof, Living with Lydia and Phua Chu Kang," M/C Journal, 10(4). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0708/09-pugsley.php>.

42

Gildersleeve, Jessica. "“Weird Melancholy” and the Modern Television Outback: Rage, Shame, and Violence in Wake in Fright and Mystery Road." M/C Journal 22, no.1 (March13, 2019). http://dx.doi.org/10.5204/mcj.1500.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

In the middle of the nineteenth century, Marcus Clarke famously described the Australian outback as displaying a “Weird Melancholy” (qtd. in Gelder 116). The strange sights, sounds, and experiences of Australia’s rural locations made them ripe for the development of the European genre of the Gothic in a new location, a mutation which has continued over the past two centuries. But what does it mean for Australia’s Gothic landscapes to be associated with the affective qualities of the melancholy? And more particularly, how and why does this Gothic effect (and affect) appear in the most accessible Gothic media of the twenty-first century, the television series? Two recent Australian television adaptations, Wake in Fright (2017, dir. Kriv Stenders) and Mystery Road (2018, dir. Rachel Perkins) provoke us to ask the question: how does their pictorial representation of the Australian outback and its inhabitants overtly express rage and its close ties to melancholia, shame and violence? More particularly, I argue that in both series this rage is turned inwards rather than outwards; rage is turned into melancholy and thus to self-destruction – which constructs an allegory for the malaise of our contemporary nation. However, here the two series differ. While Wake in Fright posits this as a never-ending narrative, in a true Freudian model of melancholics who fail to resolve or attend to their trauma, Mystery Road is more positive in its positioning, allowing the themes of apology and recognition to appear, both necessary for reparation and forward movement.Steven Bruhm has argued that a psychoanalytic model of trauma has become the “best [way to] understand the contemporary Gothic and why we crave it” (268), because the repressions and repetitions of trauma offer a means of playing out the anxieties of our contemporary nation, its fraught histories, its conceptualisations of identity, and its fears for the future. Indeed, as Bruhm states, it is precisely because of the way in which “the Gothic continually confronts us with real, historical traumas that we in the west have created” that they “also continue to control how we think about ourselves as a nation” (271). Jerrold E. Hogle agrees, noting that “Gothic fiction has always begun with trauma” (72). But it is not only that Gothic narratives are best understood as traumatic narratives; rather, Hogle posits that the Gothic is uniquely situated as a genre for dealing with the trauma of our personal and national histories because it enables us to approach the contradictions and conflicts of traumatic experience:I find that the best of the post-9/11 uses of Gothic in fiction achieve that purpose for attentive readers by using the conflicted un-naturalness basic to the Gothic itself to help us concurrently grasp and conceal how profoundly conflicted we are about the most immediate and pervasive cultural “woundings” of our western world as it has come to be. (75)Hogle’s point is critical for its attention to the different ways trauma can be dealt with in texts and by readers, returning in part to Sigmund Freud’s distinction between mourning and melancholia: where mourning is the ‘healthy’ process of working through or narrativising trauma. However, melancholia coalesces into a denial or repression of the traumatic event, and thus, as Freud suggests, its unresolved status reappears during nightmares and flashbacks, for example (Rall 171). Hogle’s praise for the Gothic, however, lies in its ability to move away from that binary, to “concurrently grasp and conceal” trauma: in other words, to respond simultaneously with mourning and with melancholy.Hogle adds to this classic perspective of melancholia through careful attention to the way in which rage inflects these affective responses. Under a psychoanalytic model, rage can be seen “as an infantile response to separation and loss” (Kahane 127). The emotional free-rein of rage, Claire Kahane points out, “disempowers us as subjects, making us subject to its regressive vicissitudes” (127; original emphasis). In Bodies That Matter, Judith Butler explicates this in more detail, making clear that this disempowerment, this inability to clearly express oneself, is what leads to melancholia. Melancholia, then, can be seen as a loss or repression of the identifiable cause of the original rage: this overwhelming emotion has masked its original target. “Insofar as grief remains unspeakable”, Butler posits, “the rage over the loss can redouble by virtue of remaining unavowed. And if that very rage over loss is publicly proscribed, the melancholic effects of such a proscription can achieve suicidal proportions” (212). The only way to “survive” rage in this mutated form of melancholia is to create what Butler terms “collective institutions for grieving”; these enablethe reassembling of community, the reworking of kinship, the reweaving of sustaining relations. And insofar as they involve the publicisation and dramatisation of death, they call to be read as life-affirming rejoinders to the dire psychic consequences of a grieving process culturally thwarted and proscribed. (212-13)Butler’s reading thus aligns with Hogle’s, suggesting that it is in our careful attendance to the horrific experience of grief (however difficult) that we could navigate towards something like resolution – not a simplified narrative of working through, to be sure, but a more ethical recognition of the trauma which diverts it from its repressive impossibilities. To further the argument, it is only by transforming melancholic rage into outrage, to respond with an affect that puts shame to work, that rage will become politically effective. So, outrage is “a socialised and mediated form of rage … directed toward identifiable and bounded others in the external world” (Kahane 127-28). Melancholia and shame might then be seen to be directly opposed to one another: the former a failure of rage, the latter its socially productive incarnation.The Australian Gothic and its repetition of a “Weird Melancholy” exhibit this affective model. Ken Gelder has emphasised the historical coincidences: since Australia was colonised around the same time as the emergence of the Gothic as a genre (115), it has always been infused with what he terms a “colonial melancholia” (119). In contemporary Gothic narratives, this is presented through the repetition of the trauma of loss and injustice, so that the colonial “history of brutal violence and exploitation” (121) is played out, over and over again, desperate for resolution. Indeed, Gelder goes so far as to claim that this is the primary fuel for the Gothic as it manifests in Australian literature and film, arguing that since it is “built upon its dispossession and killings of Aboriginal people and its foundational systems of punishment and incarceration, the colonial scene … continues to shadow Australian cultural production and helps to keep the Australian Gothic very much alive” (121).That these two recent television series depict the ways in which rage and outrage appear in a primal ‘colonial scene’ which fixes the Australian Gothic within a political narrative. Both Wake in Fright and Mystery Road are television adaptations of earlier works. Wake in Fright is adapted from Kenneth Cook’s novel of the same name (1961), and its film adaptation (1971, dir. Ted Kotcheff). Mystery Road is a continuation of the film narrative of the same name (2013, dir. Ivan Sen), and its sequel, Goldstone (2016, dir. Ivan Sen). Both narratives illustrate the shift – where the films were first viewed by a high-culture audience attracted to arthouse cinema and modernist fiction – to the re-makes that are viewed in the domestic space of the television screen and/or other devices. Likewise, the television productions were not seen as single episodes, but also linked to each network’s online on-demand streaming viewers, significantly broadening the audience for both works. In this respect, these series both domesticate and democratise the Gothic. The televised series become situated publicly, recalling the broad scale popularity of the Gothic genre, what Helen Wheatley terms “the most domestic of genres on the most domestic of media” (25). In fact, Deborah Cartmell argues that “adaptation is, indeed, the art form of democracy … a ‘freeing’ of a text from the confined territory of its author and of its readers” (8; emphasis added). Likewise, André Bazin echoes this notion that the adaptation is a kind of “digest” of the original work, “a literature that has been made more accessible through cinematic adaptation” (26; emphasis added). In this way, adaptations serve to ‘democratise’ their concerns, focussing these narratives and their themes as more publically accessible, and thus provoking the potential for a broader cultural discussion. Wake in FrightWake in Fright describes the depraved long weekend of schoolteacher John Grant, who is stuck in the rural town of Bundinyabba (“The Yabba”) after he loses all of his money in an ill-advised game of “Two Up.” Modernising the concerns of the original film, in this adaptation John is further endangered by a debt to local loan sharks, and troubled by his frequent flashbacks to his lost lover. The narrative does display drug- and alcohol-induced rage in its infamous pig-shooting (originally roo-shooting) scene, as well as the cold and threatening rage of the loan shark who suspects she will not be paid, both of which are depicted as a specifically white aggression. Overall, its primary depiction of rage is directed inward, rather than outward, and in this way becomes narrowed down to emphasise a more individual, traumatic shame. That is, John’s petulant rage after his girlfriend’s rejection of his marriage proposal manifests in his determination to stolidly drink alone while she swims in the ocean. When she drowns while he is drunk and incapable to rescue her, his inaction becomes the primary source of his shame and exacerbates his self-focused, but repressed rage. The subsequent cycles of drinking (residents of The Yabba only drink beer, and plenty of it) and gambling (as he loses over and over at Two-Up) constitute a repetition of his original trauma over her drowning, and trigger the release of his repressed rage. While accompanying some locals during their drunken pig-shooting expedition, his rage finds an outlet, resulting in the death of his new acquaintance, Doc Tydon. Like John, Doc is the victim of a self-focused rage and shame at the death of his young child and the abdication of his responsibilities as the town’s doctor. Both John and Doc depict the collapse of authority and social order in the “Weird Melancholy” of the outback (Rayner 27), but this “subversion of the stereotype of capable, confident Australian masculinity” (37) and the decay of community and social structure remains static. However, the series does not push forward towards a moral outcome or a suggestion of better actions to inspire the viewer. Even his desperate suicide attempt, what he envisions as the only ‘ethical’ way out of his nightmare, ends in failure and is covered up by the local police. The narrative becomes circular: for John is returned to The Yabba every time he tries to leave, and even in the final scene he is back in Tiboonda, returned to where he started, standing at the front of his classroom. But importantly, this cycle mimics John’s cycle of unresolved shame, suggests an inability to ‘wake’ from this nightmare of repetition, with no acknowledgement of his individual history and his complicity in the traumatic events. Although John has outlived his suicide attempt, this does not validate his survival as a rebirth. Rather, John’s refusal of responsibility and the accompanying complicity of local authorities suggests the inevitability of further self-damaging rage, shame, and violence. Outback NoirBoth Wake in Fright and Mystery Road have been described as “outback noir” (Dolgopolov 12), combining characteristics of the Gothic, the Western, and film noir in their depictions of suffering and the realisation (or abdication) of justice. Greg Dolgopolov explains that while traditional “film noir explores the moral trauma of crime on its protagonists, who are often escaping personal suffering or harrowing incidents from their pasts” (12), these examples of Australian (outback) noir are primarily concerned with “ancestral trauma – that of both Indigenous and settler. Outback noir challenges official versions of events that glide over historical massacres and current injustices” (12-13).Wake in Fright’s focus on John’s personal suffering even as his crimes could become allegories for national trauma, aligns this story with traditional film noir. Mystery Road is caught up with a more collectivised form of trauma, and with the ‘colonialism’ of outback noir means this adaptation is more effective in locating self-rage and melancholia as integral to social and cultural dilemmas of contemporary Australia. Each series takes a different path to the treatment of race relations in Australia within a small and isolated rural context. Wake in Fright chooses to ignore this historical context, setting up the cycle of John’s repression of trauma as an individual fate, and he is trapped to repeat it. On the other hand, Mystery Road, just like its cinematic precursors (Mystery Road and Goldstone), deals with race as a specific theme. Mystery Road’s nod to the noir and the Western is emphasised by the character of Detective Jay Swan: “a lone gunslinger attempting to uphold law and order” (Ward 111), he swaggers around the small township in his cowboy hat, jeans, and boots, stoically searching for clues to the disappearance of two local teenagers. Since Swan is himself Aboriginal, this transforms the representation of authority and its failures depicted in Wake in Fright. While the police in Wake in Fright uphold the law only when convenient to their own goals, and further, to undertake criminal activities themselves, in Mystery Road the authority figures – Jay himself, and his counterpart, Senior Sergeant Emma James, are prominent in the community and dedicated to the pursuit of justice. It is highly significant that this sense of justice reaches beyond the present situation. Emma’s family, the Ballantynes, have been prominent landowners and farmers in the region for over one hundred years, and have always prided themselves on their benevolence towards the local Indigenous population. However, when Emma discovers that her great-grandfather was responsible for the massacre of several young Aboriginal men at the local waterhole, she is overcome by shame. In her horrified tears we see how the legacy of trauma, ever present for the Aboriginal population, is brought home to Emma herself. As the figurehead for justice in the town, Emma is determined to label the murders accurately as a “crime” which must “be answered.” In this acknowledgement and her subsequent apology to Dot, she finds some release from this ancient shame.The only Aboriginal characters in Wake in Fright are marginal to the narrative – taxi drivers who remain peripheral to the traumas within the small town, and thus remain positioned as innocent bystanders to its depravity. However, Mystery Road is careful to avoid such reductionist binaries. Just as Emma discovers the truth about her own family’s violence, Uncle Keith, the current Aboriginal patriarch, is exposed as a sexual predator. In both cases the men, leaders in the past and the present, consider themselves as ‘righteous’ in order to mask their enraged and violent behaviour. The moral issue here is more than a simplistic exposition on race, rather it demonstrates that complexity surrounds those who achieve power. When Dot ultimately ‘inherits’ responsibility for the Aboriginal Land Rights Commission this indicates that Mystery Road concludes with two female figures of authority, both looking out for the welfare of the community as a whole. Likewise, they are involved in seeking the young woman, Shevorne, who becomes the focus of abuse and grief, and her daughter. Although Jay is ultimately responsible for solving the crime at the heart of the series, Mystery Road strives to position futurity and responsibility in the hands of its female characters and their shared sense of community.In conclusion, both television adaptations of classic movies located in Australian outback noir have problematised rage within two vastly different contexts. The adaptations Wake in Fright and Mystery Road do share similar themes and concerns in their responses to past traumas and how that shapes Gothic representation of the outback in present day Australia. However, it is in their treatment of rage, shame, and violence that they diverge. Wake in Fright’s failure to convert rage beyond melancholia means that it fails to offer any hope of resolution, only an ongoing cycle of shame and violence. But rage, as a driver for injustice, can evolve into something more positive. In Mystery Road, the anger of both individuals and the community as a whole moves beyond good/bad and black/white stereotypes of outrage towards a more productive form of shame. In doing so, rage itself can elicit a new model for a more responsible contemporary Australian Gothic narrative.References Bazin, André. “Adaptation, or the Cinema as Digest.” Film Adaptation. 1948. Ed. James Naremore. New Brunswick, NJ: Rutgers, 2000. 19-27.Bruhm, Steven. “The Contemporary Gothic: Why We Need It.” The Cambridge Companion to Gothic Fiction. Ed. Jerrold E. Hogle. Cambridge: Cambridge UP, 2002. 259-76.Butler, Judith. Bodies That Matter: On the Discursive Limits of “Sex.” London: Routledge, 1993.Cartmell, Deborah. “100+ Years of Adaptations, or, Adaptation as the Art Form of Democracy.” A Companion to Literature, Film, and Adaptation. Ed. Deborah Cartmell. Chichester: Blackwell, 2012. 1-13.Dolgopolov, Greg. “Balancing Acts: Ivan Sen’s Goldstone and ‘Outback Noir.’” Metro 190 (2016): 8-13.Gelder, Ken. “Australian Gothic.” The Routledge Companion to Gothic. Eds. Catherine Spooner and Emma McEvoy. London: Routledge, 2007. 115-23.Hogle, Jerrold E. “History, Trauma and the Gothic in Contemporary Western Fictions.” The Gothic World. Eds. Glennis Byron and Dale Townshend. London: Routledge, 2014. 72-81.Kahane, Claire. “The Aesthetic Politics of Rage.” States of Rage: Emotional Eruption, Violence, and Social Change. Eds. Renée R. Curry and Terry L. Allison. New York: New York UP, 1996. 126-45.Perkins, Rachel, dir. Mystery Road. ABC, 2018.Rall, Denise N. “‘Shock and Awe’ and Memory: The Evocation(s) of Trauma in post-9/11 Artworks.” Memory and the Wars on Terror: Australian and British Perspectives. Eds. Jessica Gildersleeve and Richard Gehrmann. Houndmills: Palgrave Macmillan, 2017. 163-82.Rayner, Jonathan. Contemporary Australian Cinema: An Introduction. Manchester: Manchester UP, 2000.Stenders, Kriv, dir. Wake in Fright. Roadshow Entertainment, 2017.Ward, Sarah. “Shadows of a Sunburnt Country: Mystery Road, the Western and the Conflicts of Contemporary Australia.” Screen Education 81 (2016): 110-15.Wheatley, Helen. “Haunted Houses, Hidden Rooms: Women, Domesticity and the Gothic Adaptation on Television.” Popular Television Drama: Critical Perspectives. Eds. Jonathan Bignell and Stephen Lacey. Manchester: Manchester UP, 2005. 149-65.

43

Brown, Malcolm David. "Doubt as Methodology and Object in the Phenomenology of Religion." M/C Journal 14, no.1 (January24, 2011). http://dx.doi.org/10.5204/mcj.334.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Photograph by Gonzalo Echeverria (2010)“I must plunge again and again in the water of doubt” (Wittgenstein 1e). The Holy Grail in the phenomenology of religion (and, to a lesser extent, the sociology of religion) is a definition of religion that actually works, but, so far, this seems to have been elusive. Classical definitions of religion—substantive (e.g. Tylor) and functionalist (e.g. Durkheim)—fail, in part because they attempt to be in three places at once, as it were: they attempt to distinguish religion from non-religion; they attempt to capture what religions have in common; and they attempt to grasp the “heart”, or “core”, of religion. Consequently, family resemblance definitions of religion replace certainty and precision for its own sake with a more pragmatic and heuristic approach, embracing doubt and putting forward definitions that give us a better understanding (Verstehen) of religion. In this paper, I summarise some “new” definitions of religion that take this approach, before proposing and defending another one, defining religion as non-propositional and “apophatic”, thus accepting that doubt is central to religion itself, as well as to the analysis of religion.The question of how to define religion has had real significance in a number of court cases round the world, and therefore it does have an impact on people’s lives. In Germany, for example, the courts ruled that Scientology was not a religion, but a business, much to the displeasure of the Church of Scientology (Aldridge 15). In the United States, some advocates of Transcendental Meditation (TM) argued that TM was not a religion and could therefore be taught in public schools without violating the establishment clause in the constitution—the separation of church and state. The courts in New Jersey, and federal courts, ruled against them. They ruled that TM was a religion (Barker 146). There are other cases that I could cite, but the point of this is simply to establish that the question has a practical importance, so we should move on.In the classical sociology of religion, there are a number of definitions of religion that are quite well known. Edward Tylor (424) defined religion as a belief in spiritual beings. This definition does not meet with widespread acceptance, the notable exception being Melford Spiro, who proposed in 1966 that religion was “an institution consisting of culturally patterned interaction with culturally postulated super-human beings” (Spiro 96, see also 91ff), and who has bravely stuck to that definition ever since. The major problem is that this definition excludes Buddhism, which most people do regard as a religion, although some people try to get round the problem by claiming that Buddhism is not really a religion, but more of a philosophy. But this is cheating, really, because a definition of religion must be descriptive as well as prescriptive; that is, it must apply to entities that are commonly recognised as religions. Durkheim, in The Elementary Forms of Religious Life, proposed that religion had two key characteristics, a separation of the sacred from the profane, and a gathering together of people in some sort of institution or community, such as a church (Durkheim 38, 44). However, religions often reject a separation of the sacred from the profane. Most Muslims and many Calvinist Christians, for example, would insist strongly that everything—including the ostensibly profane—is equally subject to the sovereignty of God. Also, some religions are more oriented to a guru-pupil kind of relationship, rather than a church community.Weber tried to argue that religion should only be defined at the end of a long process of historical and empirical study. He is often criticised for this, although there probably is some wisdom in his argument. However, there seems to be an implicit definition of religion as theodicy, accounting for the existence of evil and the existence of suffering. But is this really the central concern of all religions?Clarke and Byrne, in their book Religion Defined and Explained, construct a typology of definitions, which I think is quite helpful. Broadly speaking, there are two types of classical definition. Firstly, there are substantive definitions (6), such as Tylor’s and Spiro’s, which posit some sort of common “property” that religions “have”—“inside” them, as it were. Secondly, functionalist definitions (Clarke and Byrne 7), such as Durkheim’s, define religion primarily in terms of its social function. What matters, as far as a definition of religion is concerned, is not what you believe, but why you believe it.However, these classical definitions do not really work. I think this is because they try to do too many things. For a strict definition of religion to work, it needs to tell us (i) what religions have in common, (ii) what distinguishes religion on the one hand from non-religion, or everything that is not religion, on the other, and (iii) it needs to tell us something important about religion, what is at the core of religion. This means that a definition of religion has to be in three places at once, so to speak. Furthermore, a definition of religion has to be based on extant religions, but it also needs to have some sort of quasi-predictive capacity, the sort of thing that can be used in a court case regarding, for example, Scientology or Transcendental Meditation.It may be possible to resolve the latter problem by a gradual process of adjustment, a sort of hermeneutic circle of basing a definition on extant religions and applying it to new ones. But what about the other problem, the one of being in three places at once?Another type identified by Clarke and Byrne, in their typology of definitions, is the “family resemblance” definition (11-16). This derives from the later Wittgenstein. The “family resemblance” definition of religion is based on the idea that religions commonly share a number of features, but that no one religion has all of them. For example, there are religious beliefs, doctrines and mythos—or stories and parables. There are rituals and moral codes, institutions and clergy, prayers, spiritual emotions and experiences, etc. This approach is of course less precise than older substantive and functional definitions, but it also avoids some of the problems associated with them.It does so by rethinking the point of defining religion. Instead of being precise and rigorous for the sake of it, it tries to tell us something, to be “productive”, to help us understand religion better. It eschews certainty and embraces doubt. Its insights could be applied to some schools of philosophy (e.g. Heideggerian) and practical spirituality, because it does not focus on what is distinctive about religion. Rather, it focuses on the core of religion, and, secondarily, on what religions have in common. The family resemblance approach has led to a number of “new” definitions (post-Durkheim definitions) being proposed, all of which define religion in a less rigorous, but, I hope, more imaginative and heuristic way.Let me provide a few examples, starting with two contrasting ones. Peter Berger in the late 1960s defined religion as “the audacious attempt to conceive of the entire universe as humanly significant”(37), which implies a consciousness of an anthropocentric sacred cosmos. Later, Alain Touraine said that religion is “the apprehension of human destiny, existence, and death”(213–4), that is, an awareness of human limitations, including doubt. Berger emphasises the high place for human beings in religion, and even a sort of affected certainty, while Touraine emphasises our place as doubters on the periphery, but it seems that religion exists within a tension between these two opposites, and, in a sense, encompasses them both.Richard Holloway, former Bishop of Edinburgh in the Scottish Episcopal Church and arch-nemesis of the conservative Anglicans, such as those from Sydney, defines religion as like good poetry, not bad science. It is easy to understand that he is criticising those who see religion, particularly Christianity, as centrally opposed to Darwin and evolution. Holloway is clearly saying that those people have missed the point of their own faith. By “good poetry”, he is pointing to the significance of storytelling rather than dogma, and an open-ended discussion of ultimate questions that resists the temptation to end with “the moral of the story”. In science (at least before quantum physics), there is no room for doubt, but that is not the case with poetry.John Caputo, in a very energetic book called On Religion, proposes what is probably the boldest of the “new” definitions. He defines religion as “the love of God” (1). Note the contrast with Tylor and Spiro. Caputo does not say “belief in God”; he says “the love of God”. You might ask how you can love someone you don’t believe in, but, in a sense, this paradox is the whole point. When Caputo says “God”, he is not necessarily talking in the usual theistic or even theological terms. By “God”, he means the impossible made possible (10). So a religious person, for Caputo, is an “unhinged lover” (13) who loves the impossible made possible, and the opposite is a “loveless lout” who is only concerned with the latest stock market figures (2–3). In this sense of religious, a committed atheist can be religious and a devout Catholic or Muslim or Hindu can be utterly irreligious (2–3). Doubt can encompass faith and faith can encompass doubt. This is the impossible made possible. Caputo’s approach here has something in common with Nietzsche and especially Kierkegaard, to whom I shall return later.I would like to propose another definition of religion, within the spirit of these “new” definitions of religion that I have been discussing. Religion, at its core, I suggest, is non-propositional and apophatic. When I say that religion is non-propositional, I mean that religion will often enact certain rituals, or tell certain stories, or posit faith in someone, and that propositional statements of doctrine are merely reflections or approximations of this non-propositional core. Faith in God is not a proposition. The Eucharist is not a proposition. Prayer is not, at its core, a proposition. Pilgrimage is not a proposition. And it is these sorts of things that, I suggest, form the core of religion. Propositions are what happen when theologians and academics get their hands on religion, they try to intellectualise it so that it can be made to fit within their area of expertise—our area of expertise. But, that is not where it belongs. Propositions about rituals impose a certainty on them, whereas the ritual itself allows for courage in the face of doubt. The Maundy Thursday service in Western Christianity includes the stripping of the altar to the accompaniment of Psalm 22 (“My God, my God, why hast Thou forsaken me”), ending the service without a dismissal (Latin missa, the origin of the English “mass”) and with the church in darkness. Doubt, confusion, and bewilderment are the heart and soul of this ritual, not orthodox faith as defined propositionally.That said, religion does often involve believing, of some kind (though it is not usually as central as in Christianity). So I say that religion is non-propositional and apophatic. The word “apophatic”, though not the concept, has its roots in Greek Orthodox theology, where St Gregory Palamas argues that any statement about God—and particularly about God’s essence as opposed to God’s energies—must be paradoxical, emphasising God’s otherness, and apophatic, emphasising God’s essential incomprehensibility (Armstrong 393). To make an apophatic statement is to make a negative statement—instead of saying God is king, lord, father, or whatever, we say God is not. Even the most devout believer will recognise a sense in which God is not a king, or a lord, or a father. They will say that God is much greater than any of these things. The Muslim will say “Allahu Akhbar”, which means God is greater, greater than any human description. Even the statement “God exists” is seen to be well short of the mark. Even that is human language, which is why the Cappadocian fathers (Saints Basil the Great, Gregory of Nyssa, and Gregory Naziansus) said that they believed in God, while refusing to say that God exists.So to say that religion is at its core non-propositional is to say that religious beliefs are at their core apophatic. The idea of apophasis is that by a process of constant negation you are led into silence, into a recognition that there is nothing more that can be said. St Thomas Aquinas says that the more things we negate about God, the more we say “God is not…”, the closer we get to what God is (139). Doubt therefore brings us closer to the object of religion than any putative certainties.Apophasis does not only apply to Christianity. I have already indicated that it applies also to Islam, and the statement that God is greater. In Islam, God is said to have 99 names—or at least 99 that have been revealed to human beings. Many of these names are apophatic. Names like The Hidden carry an obviously negative meaning in English, while, etymologically, “the Holy” (al-quddu-s) means “beyond imperfection”, which is a negation of a negation. As-salaam, the All-Peaceful, means beyond disharmony, or disequilibrium, or strife, and, according to Murata and Chittick (65–6), “The Glorified” (as-subbuh) means beyond understanding.In non-theistic religions too, an apophatic way of believing can be found. Key Buddhist concepts include sunyata, emptiness, or the Void, and anatta, meaning no self, the belief or realisation that the Self is illusory. Ask what they believe in instead of the Self and you are likely to be told that you are missing the point, like the Zen pupil who confused the pointing finger with the moon. In the Zen koans, apophasis plays a major part. One well-known koan is “What is the sound of one hand clapping?” Any logical answers will be dismissed, like Thomas Aquinas’s statements about God, until the pupil gets beyond logic and achieves satori, or enlightenment. Probably the most used koan is Mu—Master Joshu is asked if a dog has Buddha-nature and replies Mu, meaning “no” or “nothing”. This is within the context of the principle that everything has Buddha-nature, so it is not logical. But this apophatic process can lead to enlightenment, something better than logic. By plunging again and again in the water of doubt, to use Wittgenstein’s words, we gain something better than certainty.So not only is apophasis present in a range of different religions—and I have given just a few examples—but it is also central to the development of religion in the Axial Age, Karl Jaspers’s term for the period from about 800-200 BCE when the main religious traditions of the world began—monotheism in Israel (which also developed into Christianity and Islam), Hinduism and Buddhism in India, Confucianism and Taoism in China, and philosophical rationalism in Greece. In the early Hindu traditions, there seems to have been a sort of ritualised debate called the Brahmodya, which would proceed through negation and end in silence. Not the silence of someone admitting defeat at the hands of the other, but the silence of recognising that the truth lay beyond them (Armstrong 24).In later Hinduism, apophatic thought is developed quite extensively. This culminates in the idea of Brahman, the One God who is Formless, beyond all form and all description. As such, all representations of Brahman are equally false and therefore all representations are equally true—hence the preponderance of gods and idols on the surface of Hinduism. There is also the development of the idea of Atman, the universal Self, and the Buddhist concept anatta, which I mentioned, is rendered anatman in Sanskrit, literally no Atman, no Self. But in advaita Hinduism there is the idea that Brahman and Atman are the same, or, more accurately, they are not two—hence advaita, meaning “not two”. This is negation, or apophasis. In some forms of present-day Hinduism, such as the International Society for Krishna Consciousness (commonly known as the Hare Krishnas), advaita is rejected. Sometimes this is characterised as dualism with respect to Brahman and Atman, but it is really the negation of non-dualism, or an apophatic negation of the negation.Even in early Hinduism, there is a sort of Brahmodya recounted in the Rig Veda (Armstrong 24–5), the oldest extant religious scripture in the world that is still in use as a religious scripture. So here we are at the beginning of Axial Age religion, and we read this account of creation:Then was not non-existent nor existent: there was no realm of air, no sky beyond it.Death was not then, nor was there aught immortal.Darkness there was: at first concealed in darkness this All was indiscriminated chaos.All that existed then was void and form less.Sages who searched with their heart's thought discovered the existent's kinship in the non-existent.Who verily knows and who can here declare it, whence it was born and whence comes this creation?The Gods are later than this world's production. Who knows then whence it first came into being?He, the first origin of this creation, whether he formed it all or did not form it,Whose eye controls this world in highest heaven, he verily knows it, or perhaps he knows not.(Rig Veda Book 10, Hymn 129, abridged)And it would seem that this is the sort of thought that spread throughout the world as a result of the Axial Age and the later spread of Axial and post-Axial religions.I could provide examples from other religious traditions. Taoism probably has the best examples, though they are harder to relate to the traditions that are more familiar in the West. “The way that is spoken is not the Way” is the most anglicised translation of the opening of the Tao Te Ching. In Sikhism, God’s formlessness and essential unknowability mean that God can only be known “by the Guru’s grace”, to quote the opening hymn of the Guru Granth Sahib.Before I conclude, however, I would like to anticipate two criticisms. First, this may only be applicable to the religions of the Axial Age and their successors, beginning with Hinduism and Buddhism, Taoism and Confucianism, and early Jewish monotheism, followed by Jainism, Christianity, Islam and so on. I would like to find examples of apophasis at the core of other traditions, including Indigenous Australian and Native American ones, for example, but that is work still to be done. Focusing on the Axial Age does historicise the argument, however, at least in contrast with a more universal concept of religion that runs the risk of falling into the ahistorical hom*o religiosus idea that humans are universally and even naturally religious. Second, this apophatic definition looks a bit elitist, defining religion in terms that are relevant to theologians and “religious virtuosi” (to use Weber’s term), but what about the ordinary believers, pew-fillers, temple-goers? In response to such criticism, one may reply that there is an apophatic strand in what Niebuhr called the religions of the disinherited. In Asia, devotion to the Buddha Amida is particularly popular among the poor, and this involves a transformation of the idea of anatta—no Self—into an external agency, a Buddha who is “without measure”, in terms of in-finite light and in-finite life. These are apophatic concepts. In the Christian New Testament, we are told that God “has chosen the foolish things of this world to shame the wise, the weak to shame the strong…, the things that are not to shame the things that are” (1 Corinthians 1:27). The things that are not are the apophatic, and these are allied with the foolish and the weak, not the educated and the powerful.One major reason for emphasising the role of apophasis in religious thought is to break away from the idea that the core of religion is an ethical one. This is argued by a number of “liberal religious” thinkers in different religious traditions. I appreciate their reasons, and I am reluctant to ally myself with their opponents, who include the more fundamentalist types as well as some vocal critics of religion like Dawkins and Hitchens. However, I said that I would return to Kierkegaard, and the reason is this. Kierkegaard distinguishes between the aesthetic, the ethical and the religious. Of course, religion has an aesthetic and an ethical dimension, and in some religions these dimensions are particularly important, but that does not make them central to religion as such. Kierkegaard regarded the religious sphere as radically different from the aesthetic or even the ethical, hence his treatment of the story of Abraham going to Mount Moriah to sacrifice his son, in obedience to God’s command. His son was not killed in the end, but Abraham was ready to do the deed. This is not ethical. This is fundamentally and scandalously unethical. Yet it is religious, not because it is unethical and scandalous, but because it pushes us to the limits of our understanding, through the waters of doubt, and then beyond.Were I attempting to criticise religion, I would say it should not go there, that, to misquote Wittgenstein, the limits of my understanding are the limits of my world, whereof we cannot understand thereof we must remain silent. Were I attempting to defend religion, I would say that this is its genius, that it can push back the limits of understanding. I do not believe in value-neutral sociology, but, in this case, I am attempting neither. ReferencesAldridge, Alan. Religion in the Contemporary World. Cambridge: Polity, 2000.Aquinas, Thomas. “Summa of Christian Teaching”. An Aquinas Reader. ed. Mary Clarke. New York: Doubleday, 1972.Armstrong, Karen. The Great Transformation. New York: Alfred A. Knopf, 2006.Barker, Eileen. New Religious Movements: a Practical Introduction. London: HMSO, 1989.Berger, Peter. The Social Reality of Religion. Harmondsworth: Penguin, 1973.Caputo, John. On Religion. London: Routledge, 2001.Clarke, Peter, and Peter Byrne, eds. Religion Defined and Explained. New York: St Martin’s Press. 1993.Durkheim, Emile. The Elementary Forms of Religious Life. New York: Free Press, 1995.Holloway, Richard. Doubts and Loves. Edinburgh: Caqnongate, 2002.Jaspers, Karl. The Origin and Goal of History. Westport, Connecticut: Greenwood Press, 1977.Kierkegaard, Søren. Either/Or. London: Penguin, 1992.———. Fear and Trembling. London: Penguin, 1986.Murata, Sachiko, and William Chittick. The Vision of Islam. St Paul, Minnesota: Paragon House, 1994.Niebuhr, H. Richard. The Social Sources of Denominationalism. New York: Holt, 1929.Spiro, Melford. “Religion: Problems of Definition and Explanation.” Anthropological Approaches to the Study of Religion. Ed. Michael Banton. London: Tavistock, 1966. 85–126.Touraine, Alain. The Post-Industrial Society. London: Wilwood House, 1974.Tylor, Edward. Primitive Culture. London: Murray, 1903.Weber, Max. The Sociology of Religion. Boston: Beacon Press, 1991.Wittgenstein, Ludwig. Remarks on Frazer’s Golden Bough. Nottingham: Brynmill Press, 1979.

44

Elliott, Susie. "Irrational Economics and Regional Cultural Life." M/C Journal 22, no.3 (June19, 2019). http://dx.doi.org/10.5204/mcj.1524.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

IntroductionAustralia is at a particular point in its history where there is a noticeable diaspora of artists and creative practitioners away from the major capitals of Sydney and Melbourne (in particular), driven in no small part by ballooning house prices of the last eight years. This has meant big changes for some regional spaces, and in turn, for the face of Australian cultural life. Regional cultural precincts are forming with tourist flows, funding attention and cultural economies. Likewise, there appears to be growing consciousness in the ‘art centres’ of Melbourne and Sydney of interesting and relevant activities outside their limits. This research draws on my experience as an art practitioner, curator and social researcher in one such region (Castlemaine in Central Victoria), and particularly from a recent interview series I have conducted in collaboration with art space in that region, Wide Open Road Art. In this, 23 regional and city-based artists were asked about the social, economic and local conditions that can and have supported their art practices. Drawing from these conversations and Bourdieu’s ideas around cultural production, the article suggests that authentic, diverse, interesting and disruptive creative practices in Australian cultural life involve the increasingly pressing need for security while existing outside the modern imperative of high consumption; of finding alternative ways to live well while entering into the shared space of cultural production. Indeed, it is argued that often it is the capacity to defy key economic paradigms, for example of ‘rational (economic) self-interest’, that allows creative life to flourish (Bourdieu Field; Ley “Artists”). While regional spaces present new opportunities for this, there are pitfalls and nuances worth exploring.Changes in Regional AustraliaAustralia has long been an urbanising nation. Since Federation our cities have increased from a third to now constituting two-thirds of the country’s total population (Gray and Lawrence 6; ABS), making us one of the most urbanised countries in the world. Indeed, as machines replaced manual labour on farms; as Australia’s manufacturing industry began its decline; and as young people in particular left the country for city universities (Gray and Lawrence), the post-war industrial-economic boom drove this widespread demographic and economic shift. In the 1980s closures of regional town facilities like banks, schools and hospitals propelled widespread belief that regional Australia was in crisis and would be increasingly difficult to sustain (Rentschler, Bridson, and Evans; Gray and Lawrence 2; Barr et al.; ABS). However, the late 1990s and early 21st century saw a turnaround that has been referred to by some as the rise of the ‘sea change’. That is, widespread renewed interest and idealisation of not just coastal areas but anywhere outside the city (Murphy). It was a simultaneous pursuit of “a small ‘a’ alternative lifestyle” and escape from rising living costs in urban areas, especially for the unemployed, single parents and those with disabilities (Murphy). This renewed interest has been sustained. The latest wave, or series of waves, have coincided with the post-GFC house price spike, of cheap credit and lenient lending designed to stimulate the economy. This initiative in part led to Sydney and Melbourne median dwelling prices rising by up to 114% in eight years (Scutt 2017), which alone had a huge influence on who was able to afford to live in city areas and who was not. Rapid population increases and diminished social networks and familial support are also considered drivers that sent a wave of people (a million since 2011) towards the outer fringes of the cities and to ‘commuter belt’ country towns (Docherty; Murphy). While the underprivileged are clearly most disadvantaged in what has actually been a global development process (see Jayne on this, and on the city as a consumer itself), artists and creatives are also a unique category who haven’t fared well with hyper-urbanisation (Ley “Artists”). Despite the class privilege that often accompanies such a career choice, the economic disadvantage art professions often involve has seen a diaspora of artists moving to regional areas, particularly those in the hinterlands around and train lines to major centres. We see the recent ‘rise of a regional bohemia’ (Regional Australia Institute): towns like Toowoomba, Byron Bay, Surf Coast, Gold Coast-Tweed, Kangaroo Valley, Wollongong, Warburton, Bendigo, Tooyday, New Norfolk, and countless more being re-identified as arts towns and precincts. In Australia in 2016–17, 1 in 6 professional artists, and 1 in 4 visual artists, were living in a regional town (Throsby and Petetskaya). Creative arts in regional Australia makes up a quarter of the nation’s creative output and is a $2.8 billion industry; and our regions particularly draw in creative practitioners in their prime productive years (aged 24 to 44) (Regional Australia Institute).WORA Conservation SeriesIn 2018 artist and curator Helen Mathwin and myself received a local shire grant to record a conversation series with 23 artists who were based in the Central Goldfields region of Victoria as well as further afield, but who had a connection to the regional arts space we run, WideOpenRoadArt (WORA). In videoed, in-depth, approximately hour-long, semi-structured interviews conducted throughout 2018, we spoke to artists (16 women and 7 men) about the relocation phenomenon we were witnessing in our own growing arts town. Most were interviewed in WORA’s roving art float, but we seized any ad hoc opportunity we had to have genuine discussions with people. Focal points were around sustainability of practice and the social conditions that supported artists’ professional pursuits. This included accessing an arts community, circles of cultural production, and the ‘art centre’; the capacity to exhibit; but also, social factors such as affordable housing and the ability to live on a low-income while having dependants; and so on. The conversations were rich with lived experiences and insights on these issues.Financial ImperativesIn line with the discussion above, the most prominent factor we noticed in the interviews was the inescapable importance of being able to live cheaply. The consistent message that all of the interviewees, both regional- and city-based, conveyed was that a career in art-making required an important independence from the need to earn a substantial income. One interviewee commented: “I do run my art as a business, I have an ABN […] it makes a healthy loss! I don’t think I’ve ever made a profit […].” Another put it: “now that I’m in [this] town and I have a house and stuff I do feel like there is maybe a bit more security around those daily things that will hopefully give me space to [make artworks].”Much has been said on the pervasive inability to monetise art careers, notably Bourdieu’s observations that art exists on an interdependent field of cultural capital, determining for itself an autonomous conception of value separate to economics (Bourdieu, Field 39). This is somewhat similar to the idea of art as a sacred phenomenon irreducible to dollar terms (Abbing 38; see also Benjamin’s “aura”; “The Work of Art”). Art’s difficult relationship with commodification is part of its heroism that Benjamin described (Benjamin Charles Baudelaire 79), its potential to sanctify mainstream society by staying separate to the lowly aspirations of commerce (Ley “Artists” 2529). However, it is understood, artists still need to attain professional education and capacities, yet they remain at the bottom of the income ladder not only professionally, but in the case of visual artists, they remain at the bottom of the creative income hierarchies as well. Further to this, within visual arts, only a tiny proportion achieve financially backed success (Menger 277). “Artistic labour markets are characterised by high risk of failure, excess supply of recruits, low artistic income level, skewed income distribution and multiple jobholding” (Mangset, Torvik Heian, Kleppe, and Løyland; Menger). Mangset et al. point to ideas that have long surrounded the “charismatic artist myth,” of a quasi-metaphysical calling to be an artist that can lead one to overlook the profession’s vast pitfalls in terms of economic sustainability. One interviewee described it as follows: “From a very young age I wanted to be an artist […] so there’s never been a time that I’ve thought that’s not what I’m doing.” A 1% rule seems widely acknowledged in how the profession manages the financial winners against those who miss out; the tiny proportion of megastar artists versus a vast struggling remainder.As even successful artists often dip below the poverty line between paid engagements, housing costs can make the difference between being able to live in an area and not (Turnbull and Whitford). One artist described:[the reason we moved here from Melbourne] was financial, yes definitely. We wouldn’t have been able to purchase a property […] in Melbourne, we would not have been able to live in place that we wanted to live, and to do what we wanted to do […]. It was never an option for us to get a big mortgage.Another said:It partly came about as a financial practicality to move out here. My partner […] wanted to be in the bush, but I was resistant at first, we were in Melbourne but we just couldn’t afford Melbourne in the end, we had an apartment, we had a studio. My partner was a cabinet maker then. You know, just every month all our money went to rent and we just couldn’t manage anymore. So we thought, well maybe if we come out to the bush […] It was just by a happy accident that we found a property […] that we could afford, that was off-grid so it cut the bills down for us [...] that had a little studio and already had a little cottage on there that we could rent that out to get money.For a prominent artist we spoke to this issue was starkly reflected. Despite large exhibitions at some of the highest profile galleries in regional Victoria, the commissions offered for these shows were so insubstantial that the artist and their family had to take on staggering sums of personal debt to execute the ambitious and critically acclaimed shows. Another very successful artist we interviewed who had shown widely at ‘A-list’ international arts institutions and received several substantial grants, spoke of their dismay and pessimism at the idea of financial survival. For all artists we spoke to, pursuing their arts practice was in constant tension with economic imperatives, and their lives had all been shaped by the need to make shrewd decisions to continue practising. There were two artists out of the 23 we interviewed who considered their artwork able to provide full-time income, although this still relied on living costs remaining extremely low. “We are very lucky to have bought a very cheap property [in the country] that I can [also] have my workshop on, so I’m not paying for two properties in Melbourne […] So that certainly takes a fair bit of pressure off financially.” Their co-interviewee described this as “pretty luxurious!” Notably, the two who thought they could live off their art practices were both men, mid-career, whose works were large, spectacular festival items, which alongside the artists’ skill and hard work was also a factor in the type of remuneration received.Decongested LivingBeyond more affordable real estate and rental spaces, life outside our cities offers other benefits that have particular relevance to creative practitioners. Opera and festival director Lindy Hume described her move to the NSW South Coast in terms of space to think and be creative. “The abundance of time, space and silence makes living in places like [Hume’s town] ideal for creating new work” (Brown). And certainly, this was a theme that arose frequently in our interviews. Many of our regionally based artists were in part choosing the de-pressurised space of non-metro areas, and also seeking an embedded, daily connection to nature for themselves, their art-making process and their families. In one interview this was described as “dreamtime”. “Some of my more creative moments are out walking in the forest with the dog, that sort of semi-daydreamy thing where your mind is taken away by the place you’re in.”Creative HubsAll of our regional interviewees mentioned the value of the local community, as a general exchange, social support and like-minded connection, but also specifically of an arts community. Whether a tree change by choice or a more reactive move, the diaspora of artists, among others, has led to a type of rural renaissance in certain popular areas. Creative hubs located around the country, often in close proximity to the urban centres, are creating tremendous opportunities to network with other talented people doing interesting things, living in close proximity and often open to cross-fertilisation. One said: “[Castlemaine] is the best place in Australia, it has this insane cultural richness in a tiny town, you can’t go out and not meet people on the street […] For someone who has not had community in their life that is so gorgeous.” Another said:[Being an artist here] is kind of easy! Lots of people around to connect—with […] other artists but also creatively minded people [...] So it means you can just bump into someone from down the street and have an amazing conversation in five minutes about some amazing thing! […] There’s a concentration here that works.With these hubs, regional spaces are entering into a new relevance in the sphere of cultural production. They are generating unique and interesting local creative scenes for people to live amongst or visit, and generating strong local arts economies, tourist economies, and funding opportunities (Rentschler, Bridson, and Evans). Victoria in particular has burgeoned, with tourist flows to its regions increasing 13 per cent in 5 years and generating tourism worth $10 billion (Tourism Victoria). Victoria’s Greater Bendigo is Australia’s most popularly searched tourist destination on Trip Advisor, with tourism increasing 52% in 10 years (Boland). Simultaneously, funding flows have increased to regional zones, as governments seek to promote development outside Australia’s urban centres and are confident in the arts as a key strategy in boosting health, economies and overall wellbeing (see Rentschler, Bridson, and Evans; see also the 2018 Regional Centre for Culture initiative, Boland). The regions are also an increasingly relevant participant in national cultural life (Turnbull and Whitford; Mitchell; Simpson; Woodhead). Opportunities for an openness to productive exchange between regional and metropolitan sites appear to be growing, with regional festivals and art events gaining importance and unique attributes in the consciousness of the arts ‘centre’ (see for example Fairley; Simpson; Farrelly; Woodhead).Difficulties of Regional LocationDespite this, our interviews still brought to light the difficulties and barriers experienced living as a regional artist. For some, living in regional Victoria was an accepted set-back in their ambitions, something to be concealed and counteracted with education in reputable metropolitan art schools or city-based jobs. For others there was difficulty accessing a sympathetic arts community—although arts towns had vibrant cultures, certain types of creativity were preferred (often craft-based and more community-oriented). Practitioners who were active in maintaining their links to a metropolitan art scene voiced more difficulty in fitting in and successfully exhibiting their (often more conceptual or boundary-pushing) work in regional locations.The Gentrification ProblemThe other increasingly obvious issue in the revivification of some non-metropolitan areas is that they can and are already showing signs of being victims of their own success. That is, some regional arts precincts are attracting so many new residents that they are ceasing to be the low-cost, hospitable environments for artists they once were. Geographer David Ley has given attention to this particular pattern of gentrification that trails behind artists (Ley “Artists”). Ley draws from Florida’s ideas of late capitalism’s ascendency of creativity over the brute utilitarianism of the industrial era. This has got to the point that artists and creative professionals have an increasing capacity to shape and generate value in areas of life that were previous overlooked, especially with built environments (2529). Now more than ever, there is the “urbane middle-class” pursuing ‘the swirling milieu of artists, bohemians and immigrants” (Florida) as they create new, desirable landscapes with the “refuse of society” (Benjamin Charles Baudelaire 79; Ley New Middle Class). With Australia’s historic shifts in affordability in our major cities, this pattern that Ley identified in urban built environments can be seen across our states and regions as well.But with gentrification comes increased costs of living, as housing, shops and infrastructure all alter for an affluent consumer-resident. This diminishes what Bourdieu describes as “the suspension and removal of economic necessity” fundamental to the avant-garde (Bourdieu Distinction 54). That is to say, its relief from heavy pressure to materially survive is arguably critical to the reflexive, imaginative, and truly new offerings that art can provide. And as argued earlier, there seems an inbuilt economic irrationality in artmaking as a vocation—of dedicating one’s energy, time and resources to a pursuit that is notoriously impoverishing. But this irrationality may at the same time be critical to setting forth new ideas, perspectives, reflections and disruptions of taken-for-granted social assumptions, and why art is so indispensable in the first place (Bourdieu Field 39; Ley New Middle Class 2531; Weber on irrationality and the Enlightenment Project; also Adorno’s the ‘primitive’ in art). Australia’s cities, like those of most developed nations, increasingly demand we busy ourselves with the high-consumption of modern life that makes certain activities that sit outside this almost impossible. As gentrification unfolds from the metropolis to the regions, Australia faces a new level of far-reaching social inequality that has real consequences for who is able to participate in art-making, where these people can live, and ultimately what kind of diversity of ideas and voices participate in the generation of our national cultural life. ConclusionThe revival of some of Australia’s more popular regional towns has brought new life to some regional areas, particularly in reshaping their identities as cultural hubs worth experiencing, living amongst or supporting their development. Our interviews brought to life the significant benefits artists have experienced in relocating to country towns, whether by choice or necessity, as well as some setbacks. It was clear that economics played a major role in the demographic shift that took place in the area being examined; more specifically, that the general reorientation of social life towards consumption activities are having dramatic spatial consequences that we are currently seeing transform our major centres. The ability of art and creative practices to breathe new life into forgotten and devalued ideas and spaces is a foundational attribute but one that also creates a gentrification problem. Indeed, this is possibly the key drawback to the revivification of certain regional areas, alongside other prejudices and clashes between metro and regional cultures. It is argued that the transformative and redemptive actions art can perform need to involve the modern irrationality of not being transfixed by matters of economic materialism, so as to sit outside taken-for-granted value structures. This emphasises the importance of equality and open access in our spaces and landscapes if we are to pursue a vibrant, diverse and progressive national cultural sphere.ReferencesAbbing, Hans. Why Artists Are Poor: The Exceptional Economy of the Arts. Amsterdam: Amsterdam UP, 2002.Adorno, Theodor. Aesthetic Theory. London: Routledge, 1983.Australian Bureau of Statistics. “Population Growth: Capital City Growth and Development.” 4102.0—Australian Social Trends. Canberra: Australian Bureau of Sttaistics, 1996. <http://www.abs.gov.au/ausstats/abs@.nsf/2f762f95845417aeca25706c00834efa/924739f180990e34ca2570ec0073cdf7!OpenDocument>.Barr, Neil, Kushan Karunaratne, and Roger Wilkinson. Australia’s Farmers: Past, Present and Future. Land and Water Resources Research and Development Corporation, 2005. 1 Mar. 2019 <http://inform.regionalaustralia.org.au/industry/agriculture-forestry-and-fisheries/item/australia-s-farmers-past-present-and-future>.Benjamin, Walter. Charles Baudelaire: A Lyric Poet in the Era of High Capitalism. London: NLB, 1973.———. “The Work of Art in the Age of Mechanical Reproduction.” Illuminations. Ed. Hannah Arendt. Trans. Harry Zohn. New York: Schocken Books, 1969.Boland, Brooke. “What It Takes to Be a Leading Regional Centre of Culture.” Arts Hub 18 July 2018. 1 Mar. 2019 <https://www.artshub.com.au/festival/news-article/sponsored-content/festivals/brooke-boland/what-it-takes-to-be-a-leading-regional-centre-of-culture-256110>.Bourdieu, Pierre. Distinction. Cambridge, MA: Harvard UP, 1984.———. The Field of Cultural Production. New York: Columbia UP, 1993.Brown, Bill. “‘Restless Giant’ Lures Queensland Opera’s Artistic Director Lindy Hume to the Regional Art Movement.” ABC News 13 Sep. 2017. 10 Mar. 2019 <https://www.abc.net.au/news/2017-09-12/regional-creative-industries-on-the-rise/8895842>.Docherty, Glenn. “Why 5 Million Australians Can’t Get to Work, Home or School on Time.” Sydney Morning Herald 17 Feb. 2019. 10 Mar. 2019 <https://www.smh.com.au/national/why-5-million-australians-can-t-get-to-work-home-or-school-on-time-20190215-p50y1x.html>.Fairley, Gina. “Big Hit Exhibitions to See These Summer Holidays.” Arts Hub 14 Dec. 2018. 1 Mar. 2019 <https://visual.artshub.com.au/news-article/news/visual-arts/gina-fairley/big-hit-exhibitions-to-see-these-summer-holidays-257016>.Farrelly, Kate. “Bendigo: The Regional City That’s Transformed into a Foodie and Cultural Hub.” Domain 9 Apr. 2019. 10 Mar. 2019 <https://www.domain.com.au/news/bendigo-the-regional-city-you-didnt-expect-to-become-a-foodie-and-cultural-hub-813317/>.Florida, Richard. “A Creative, Dynamic City Is an Open, Tolerant City.” The Globe and Mail 24 Jun. 2002: T8.Gray, Ian, and Geoffrey Lawrence. A Future For Regional Australia: Escaping Global Misfortune. Cambridge: Cambridge University Press, 2001.Hume, Lindy. Restless Giant: Changing Cultural Values in Regional Australia. Strawberry Hills: Currency House, 2017.Jayne, Mark. Cities and Consumption. London: Routledge, 2005.Ley, David. The New Middle Class and the Remaking of the Central City. Oxford: Oxford University Press, 1996.———. “Artists, Aestheticisation and Gentrification.” Urban Studies 40.12 (2003): 2527–44.Menger, Pierre-Michel. “Artistic Labor Markets: Contingent Works, Excess Supply and Occupational Risk Management.” Handbook of the Economics of Art and Culture. Eds. Victor Ginsburgh and David Throsby. Amsterdam: Elsevier, 2006. 766–811.Mangset, Per, Mari Torvik Heian, Bard Kleppe and Knut Løyland. “Why Are Artists Getting Poorer: About the Reproduction of Low Income among Artists.” International Journal of Cultural Policy 24.4 (2018): 539-58.Mitchell, Scott. “Want to Start Collecting Art But Don’t Know Where to Begin? Trust Your Own Taste, plus More Tips.” ABC Life, 31 Mar. 2019 <https://www.abc.net.au/life/tips-for-buying-art-starting-collection/10084036>.Murphy, Peter. “Sea Change: Re-Inventing Rural and Regional Australia.” Transformations 2 (March 2002).Regional Australia Institute. “The Rise of the Regional Bohemians.” Regional Australia Institute 24 May. 2017. 1 Mar. 2019 <http://www.regionalaustralia.org.au/home/2017/05/rise-regional-bohemians-painting-new-picture-arts-culture-regional-australia/>.Rentschler, Ruth, Kerrie Bridson, and Jody Evans. Regional Arts Australia Stats and Stories: The Impact of the Arts in Regional Australia. Regional Arts Australia [n.d.]. <https://www.cacwa.org.au/documents/item/477>.Simpson, Andrea. “The Regions: Delivering Exceptional Arts Experiences to the Community.” ArtsHub 11 Apr. 2019. <https://visual.artshub.com.au/news-article/sponsored-content/visual-arts/andrea-simpson/the-regions-delivering-exceptional-arts-experiences-to-the-community-257752>.

45

Rocavert, Carla. "Aspiring to the Creative Class: Reality Television and the Role of the Mentor." M/C Journal 19, no.2 (May4, 2016). http://dx.doi.org/10.5204/mcj.1086.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Introduction Mentors play a role in real life, just as they do in fiction. They also feature in reality television, which sits somewhere between the two. In fiction, mentors contribute to the narrative arc by providing guidance and assistance (Vogler 12) to a mentee in his or her life or professional pursuits. These exchanges are usually characterized by reciprocity, the need for mutual recognition (Gadamer 353) and involve some kind of moral question. They dramatise the possibilities of mentoring in reality, to provide us with a greater understanding of the world, and our human interaction within it. Reality television offers a different perspective. Like drama it uses the plot device of a mentor character to heighten the story arc, but instead of focusing on knowledge-based portrayals (Gadamer 112) of the mentor and mentee, the emphasis is instead on the mentee’s quest for ascension. In attempting to transcend their unknownness (Boorstin) contestants aim to penetrate an exclusive creative class (Florida). Populated by celebrity chefs, businessmen, entertainers, fashionistas, models, socialites and talent judges (to name a few), this class seemingly adds authenticity to ‘competitions’ and other formats. While the mentor’s role, on the surface, is to provide divine knowledge and facilitate the journey, a different agenda is evident in the ways carefully scripted (Booth) dialogue heightens the drama through effusive praise (New York Daily News) and “tactless” (Woodward), humiliating (Hirschorn; Winant 69; Woodward) and cruel sentiments. From a screen narrative point of view, this takes reality television as ‘storytelling’ (Aggarwal; Day; Hirschorn; “Reality Writer”; Rupel; Stradal) into very different territory. The contrived and later edited (Crouch; Papacharissi and Mendelson 367) communication between mentor and mentee not only renders the relationship disingenuous, it compounds the primary ethical concerns of associated Schadenfreude (Balasubramanian, Forstie and van den Scott 434; Cartwright), and the severe financial inequality (Andrejevic) underpinning a multi-billion dollar industry (Hamilton). As upward mobility and instability continue to be ubiquitously portrayed in 21st century reality entertainment under neoliberalism (Sender 4; Winant 67), it is with increasing frequency that we are seeing the systematic reinvention of the once significant cultural and historical role of the mentor. Mentor as Fictional Archetype and Communicator of ThemesDepictions of mentors can be found across the Western art canon. From the mythological characters of Telemachus’ Athena and Achilles’ Chiron, to King Arthur’s Merlin, Cinderella’s Fairy Godmother, Jim Hawkins’ Long John Silver, Frodo’s Gandalf, Batman’s Alfred and Marty McFly’s Doc Emmett Brown (among many more), the dramatic energy of the teacher, expert or supernatural aid (Vogler 39) has been timelessly powerful. Heroes, typically, engage with a mentor as part of their journey. Mentor types range extensively, from those who provide motivation, inspiration, training or gifts (Vogler), to those who may be dark or malevolent, or have fallen from grace (such as Michael Douglas’ Gordon Gekko in Wall Street 1987, or the ex-tribute Haymitch in The Hunger Games, 2012). A good drama usually complicates the relationship in some way, exploring initial reluctance from either party, or instances of tragedy (Vogler 11, 44) which may prevent the relationship achieving its potential. The intriguing twist of a fallen or malevolent mentor additionally invites the audience to morally analyze the ways the hero responds to what the mentor provides, and to question what our teachers or superiors tell us. In television particularly, long running series such as Mad Men have shown how a mentoring relationship can change over time, where “non-rational” characters (Buzzanell and D’Enbeau 707) do not necessarily maintain reciprocity or equality (703) but become subject to intimate, ambivalent and erotic aspects.As the mentor in fiction has deep cultural roots for audiences today, it is no wonder they are used, in a variety of archetypal capacities, in reality television. The dark Simon Cowell (of Pop Idol, American Idol, Britain’s Got Talent, America’s Got Talent and The X-Factor series) and the ‘villainous’ (Byrnes) Michelin-starred Marco Pierre White (Hell’s Kitchen, The Chopping Block, Marco Pierre White’s Kitchen Wars, MasterChef Australia, New Zealand, South Africa) provide reality writers with much needed antagonism (Rupel, Stradal). Those who have fallen from grace, or allowed their personal lives to play out in tabloid sagas such as Britney Spears (Marikar), or Caitlyn Jenner (Bissinger) provide different sources of conflict and intrigue. They are then counterbalanced with or repackaged as the good mentor. Examples of the nurturer who shows "compassion and empathy" include American Idol’s Paula Abdul (Marche), or the supportive Jennifer Hawkins in Next Top Model (Thompson). These distinctive characters help audiences to understand the ‘reality’ as a story (Crouch; Rupel; Stradal). But when we consider the great mentors of screen fiction, it becomes clear how reality television has changed the nature of story. The Karate Kid I (1984) and Good Will Hunting (1998) are two examples where mentoring is almost the exclusive focus, and where the experience of the characters differs greatly. In both films an initially reluctant mentor becomes deeply involved in the mentee’s project. They act as a special companion to the hero in the face of isolation, and, significantly, reveal a tragedy of their own, providing a nexus through which the mentee can access a deeper kind of truth. Not only are they flawed and ordinary people (they are not celebrities within the imagined worlds of the stories) who the mentee must challenge and learn to truly respect, they are “effecting and important” (Maslin) in reminding audiences of those hidden idiosyncrasies that open the barriers to friendship. Mentors in these stories, and many others, communicate themes of class, culture, talent, jealousy, love and loss which inform ideas about the ethical treatment of the ‘other’ (Gadamer). They ultimately prove pivotal to self worth, human confidence and growth. Very little of this thematic substance survives in reality television (see comparison of plots and contrasting modes of human engagement in the example of The Office and Dirty Jobs, Winant 70). Archetypally identifiable as they may be, mean judges and empathetic supermodels as characters are concerned mostly with the embodiment of perfection. They are flawless, untouchable and indeed most powerful when human welfare is at stake, and when the mentee before them faces isolation (see promise to a future ‘Rihanna’, X-Factor USA, Season 2, Episode 1 and Tyra Banks’ Next Top Model tirade at a contestant who had not lived up to her potential, West). If connecting with a mentor in fiction has long signified the importance of understanding of the past, of handing down tradition (Gadamer 354), and of our fascination with the elder, wiser other, then we can see a fundamental shift in narrative representation of mentors in reality television stories. In the past, as we have opened our hearts to such characters, as a facilitator to or companion of the hero, we have rehearsed a sacred respect for the knowledge and fulfillment mentors can provide. In reality television the ‘drama’ may evoke a fleeting rush of excitement at the hero’s success or failure, but the reality belies a pronounced distancing between mentor and mentee. The Creative Class: An Aspirational ParadigmThemes of ascension and potential fulfillment are also central to modern creativity discourse (Runco; Runco 672; United Nations). Seen as the driving force of the 21st century, creativity is now understood as much more than art, capable of bringing economic prosperity (United Nations) and social cohesion to its acme (United Nations xxiii). At the upper end of creative practice, is what Florida called “the creative class: a fast growing, highly educated, and well-paid segment of the workforce” (on whose expertise corporate profits depend), in industries ranging “from technology to entertainment, journalism to finance, high-end manufacturing to the arts” (Florida). Their common ethos is centered on individuality, diversity, and merit; eclipsing previous systems focused on ‘shopping’ and theme park consumerism and social conservatism (Eisinger). While doubts have since been raised about the size (Eisinger) and financial practices (Krätke 838) of the creative class (particularly in America), from an entertainment perspective at least, the class can be seen in full action. Extending to rich housewives, celebrity teen mothers and even eccentric duck hunters and swamp people, the creative class has caught up to the more traditional ‘star’ actor or music artist, and is increasingly marketable within world’s most sought after and expensive media spaces. Often reality celebrities make their mark for being the most outrageous, the cruelest (Peyser), or the weirdest (Gallagher; Peyser) personalities in the spotlight. Aspiring to the creative class thus, is a very public affair in television. Willing participants scamper for positions on shows, particularly those with long running, heavyweight titles such as Big Brother, The Bachelor, Survivor and the Idol series (Hill 35). The better known formats provide high visibility, with the opportunity to perform in front of millions around the globe (Frere-Jones, Day). Tapping into the deeply ingrained upward-mobility rhetoric of America, and of Western society, shows are aided in large part by 24-hour news, social media, the proliferation of celebrity gossip and the successful correlation between pop culture and an entertainment-style democratic ideal. As some have noted, dramatized reality is closely tied to the rise of individualization, and trans-national capitalism (Darling-Wolf 127). Its creative dynamism indeed delivers multi-lateral benefits: audiences believe the road to fame and fortune is always just within reach, consumerism thrives, and, politically, themes of liberty, egalitarianism and freedom ‘provide a cushioning comfort’ (Peyser; Pinter) from the domestic and international ills that would otherwise dispel such optimism. As the trials and tests within the reality genre heighten the seriousness of, and excitement about ascending toward the creative elite, show creators reproduce the same upward-mobility themed narrative across formats all over the world. The artifice is further supported by the festival-like (Grodin 46) symbology of the live audience, mass viewership and the online voting community, which in economic terms, speaks to the creative power of the material. Whether through careful manipulation of extra media space, ‘game strategy’, or other devices, those who break through are even more idolized for the achievement of metamorphosing into a creative hero. For the creative elite however, who wins ‘doesn’t matter much’. Vertical integration is the priority, where the process of making contestants famous is as lucrative as the profits they will earn thereafter; it’s a form of “one-stop shopping” as the makers of Idol put it according to Frere-Jones. Furthermore, as Florida’s measures and indicators suggested, the geographically mobile new creative class is driven by lifestyle values, recreation, participatory culture and diversity. Reality shows are the embodiment this idea of creativity, taking us beyond stale police procedural dramas (Hirschorn) and racially typecast family sitcoms, into a world of possibility. From a social equality perspective, while there has been a notable rise in gay and transgender visibility (Gamson) and stories about lower socio-economic groups – fast food workers and machinists for example – are told in a way they never were before, the extent to which shows actually unhinge traditional power structures is, as scholars have noted (Andrejevic and Colby 197; Schroeder) open to question. As boundaries are nonetheless crossed in the age of neoliberal creativity, the aspirational paradigm of joining a new elite in real life is as potent as ever. Reality Television’s Mentors: How to Understand Their ‘Role’Reality television narratives rely heavily on the juxtaposition between celebrity glamour and comfort, and financial instability. As mentees put it ‘all on the line’, storylines about personal suffering are hyped and molded for maximum emotional impact. In the best case scenarios mentors such as Caitlyn Jenner will help a trans mentee discover their true self by directing them in a celebrity-style photo shoot (see episode featuring Caitlyn and Zeam, Logo TV 2015). In more extreme cases the focus will be on an adopted contestant’s hopes that his birth mother will hear him sing (The X Factor USA, Season 2, Episode 11 Part 1), or on a postal clerk’s fear that elimination will mean she has to go back “to selling stamps” (The X Factor US - Season 2 Episode 11 Part 2). In the entrepreneurship format, as Woodward pointed out, it is not ‘help’ that mentees are given, but condescension. “I have to tell you, my friend, that this is the worst idea I’ve ever heard. You don’t have a clue about how to set up a business or market a product,” Woodward noted as the feedback given by one elite businessman on The Shark Tank (Woodward). “This is a five million dollar contract and I have to know that you can go the distance” (The X Factor US – Season 2 Episode 11, Part 1) Britney Spears warned to a thirteen-year-old contestant before accepting her as part of her team. In each instance the fictitious premise of being either an ‘enabler’ or destroyer of dreams is replayed and slightly adapted for ongoing consumer interest. This lack of shared experience and mutual recognition in reality television also highlights the overt, yet rarely analyzed focus on the wealth of mentors as contrasted with their unstable mentees. In the respective cases of The X Factor and I Am Cait, one of the wealthiest moguls in entertainment, Cowell, reportedly contracts mentors for up to $15 million per season (Nair); Jenner’s performance in I Am Cait was also set to significantly boost the Kardashian empire (reportedly already worth $300 million, Pavia). In both series, significant screen time has been dedicated to showing the mentors in luxurious beachside houses, where mentees may visit. Despite the important social messages embedded in Caitlyn’s story (which no doubt nourishes the Kardashian family’s generally more ersatz material), the question, from a moral point of view becomes: would these mentors still interact with that particular mentee without the money? Regardless, reality participants insist they are fulfilling their dreams when they appear. Despite the preplanning, possibility of distress (Australia Network News; Bleasby) and even suicide (Schuster), as well as the ferocity of opinion surrounding shows (Marche) the parade of a type of ‘road of trials’ (Vogler 189) is enough to keep a huge fan base interested, and hungry for their turn to experience the fortune of being touched by the creative elite; or in narrative terms, a supernatural aid. ConclusionThe key differences between reality television and artistic narrative portrayals of mentors can be found in the use of archetypes for narrative conflict and resolution, in the ways themes are explored and the ways dialogue is put to use, and in the focus on and visibility of material wealth (Frere-Jones; Peyser). These differences highlight the political, cultural and social implications of exchanging stories about potential fulfillment, for stories about ascension to the creative class. Rather than being based on genuine reciprocity, and understanding of human issues, reality shows create drama around the desperation to penetrate the inner sanctum of celebrity fame and fortune. In fiction we see themes based on becoming famous, on gender transformation, and wealth acquisition, such as in the films and series Almost Famous (2000), The Bill Silvers Show (1955-1959), Filthy Rich (1982-1983), and Tootsie (1982), but these stories at least attempt to address a moral question. Critically, in an artistic - rather than commercial context – the actors (who may play mentees) are not at risk of exploitation (Australia Network News; Bleasby; Crouch). Where actors are paid and recognized creatively for their contribution to an artistic work (Rupel), the mentee in reality television has no involvement in the ways action may be set up for maximum voyeuristic enjoyment, or manipulated to enhance scandalous and salacious content which will return show and media profits (“Reality Show Fights”; Skeggs and Wood 64). The emphasis, ironically, from a reality production point of view, is wholly on making the audience believe (Papacharissi and Mendelson 367) that the content is realistic. This perhaps gives some insight as to why themes of personal suffering and instability are increasingly evident across formats.On an ethical level, unlike the knowledge transferred through complex television plots, or in coming of age films (as cited above) about the ways tradition is handed down, and the ways true mentors provide altruistic help in human experience; in reality television we take away the knowledge that life, under neoliberalism, is most remarkable when one is handpicked to undertake a televised journey featuring their desire for upward mobility. The value of the mentoring in these cases is directly proportionate to the financial objectives of the creative elite.ReferencesAggarwal, Sirpa. “WWE, A&E Networks, and Simplynew Share Benefits of White-Label Social TV Solutions at the Social TV Summit.” Arktan 25 July 2012. 1 August 2014 <http://arktan.com/wwe-ae-networks-and-simplynew-share-benefits-of-white-label-social-tv-solutions-at-the-social-tv-summit/>. Andrejevic, Mark. “The Work of Being Watched: Interactive Media and the Exploitation of Self-Disclosure.” Critical Studies in Media Communication 19.2 (2002): 230–48.Andrejevic, Mark, and Dean Colby. “Racism and Reality TV: The Case of MTV's Road Rules”. How Real Is Reality TV? Essays on Representation and Truth. Ed. David. S. Escoffery. Jefferson: McFarland and Company, 2006. 195–210. Balasubramanian, Savina, Clare Forstie, and Lisa-Jo K. van den Scott. “Shining Stars, Blind Sides, and 'Real' Realities: Exit Rituals, Eulogy Work, and Allegories in Reality Television.” Journal of Contemporary Ethnography 44.4 (2015): 417-49. Bissinger, Buz. “Caitlyn Jenner: The Full Story.” Vanity Fair 25 June 2015. 13 April 2016 <http://www.vanityfair.com/hollywood/2015/06/caitlyn-jenner-bruce-cover-annie-leibovitz>. Bleasby, Tom. “You Are Literally Watching on TV the Worst Experience of My Life.” Twitter @TomBleasby 12 Oct. 2015.Boorstin, Daniel J. The Image: A Guide to Pseudo-Events in America. 25th anniversary ed. New York: Vintage Books, 1987 (1962). Booth, William. “Reality Is Only an Illusion, Writers Say: Hollywood Scribes Want a Cut of Not-So-Unscripted Series.” The Washington Post 10 Aug. 2004. 10 April 2016 <http://www.washingtonpost.com/wp-dyn/articles/A53032-2004Aug9.html>.Buzzanell, Patrice, and Suzy D’Enbeau. “Intimate, Ambivalent and Erotic Mentoring: Popular Culture and Mentor–Mentee Relational Processes in Mad Men.” Human Relations 67.6 (2014): 695–714.Byrnes, Holly. “Michelin-Starred Mentor Marco Pierre White Says He’s No MasterChef Villain”. The Daily Telegraph 11 July 2015. 11 April 2016 <http://www.dailytelegraph.com.au/entertainment/michelinstarred-mentor-marco-pierre-white-says-hes-no-masterchef-villain/news-story/88c0f5df8390ddd07c4a67cdf8c9ea66>. “Caitlyn Jenner & Zeam | Beautiful as I Want to Be.” Logo TV 28 Oct. 2015. 8 Jan. 2016 <https://www.youtube.com/watch?v=R0mDFzBEYOY>.Creative Economy Report: The Challenge of Assessing the Creative Economy: Towards Informed Policy Making. Geneva: United Nations; UNCTAD, 2008. 5 Jan. 2015 <http://unctad.org/en/Docs/ditc20082cer_en.pdf>.Creative Economy Report: A Feasible Development Option. Geneva: United Nations; UNCTAD, 2010. 5 Jan. 2015 <http://unctad.org/en/Docs/ditctab20103_en.pdf>.Crouch, Michael. “13 Secrets Reality TV Show Producers Won’t Tell You.” Readers Digest 21 Feb. 2016. 15 Mar. 2016 <http://www.rd.com/culture/13-secrets-reality-tv-show-producers-wont-tell-you/>. Cartwright, Martina. “Tantalized by Train Wreck Reality Television.” Psychology Today 31 Jan. 2013. 1 June 2014 <https://www.psychologytoday.com/blog/food-thought/201301/tantalized-train-wreck-reality-television>. Day, Elizabeth. “Why Reality TV Works.” The Guardian (UK) 21 Nov. 2010. 14 July 2014 <http://www.theguardian.com/tv-and-radio/2010/nov/21/why-reality-tv-works> Darling-Wolf, Fabienne. “World Citizens ‘a la francaise’: Star Academy and the Negotiation of ‘French Identities’.” The Politics of Reality Television: Global Perspectives. Eds. Marwan M. Kraidy and Katherine Sender. New York: Routledge, 2011. 127-39. Eisinger, Peter. “Richard Florida, The Rise of the Creative Class.” Political Science 55 (2003): 82-83. Frere-Jones, Sasha. “Idolatry: Everybody’s a Critic.” New Yorker Magazine 19 May 2008. 10 Jan. 2016 <http://www.newyorker.com/magazine/2008/05/19/idolatry>.Gadamer, Hans-Georg. Truth and Method. Trans. Joel Weinsheimer and Donald D. Marshall. 2nd ed. London: Continuum Publishing Group, 2004 (1975). Gallagher, Brenden. “The 10 Weirdest Reality TV Shows of All Time.” VH1 28 Aug 2015. 10 Jan. 2016 <http://www.vh1.com/news/200027/10-weirdest-reality-tv-shows/>.Greenwood, Carl. “Simon Cowell Returns to X Factor after Signing £25 Million Deal Making Him the Highest Paid Entertainer Ever.” Mirror Online 19 Dec. 2013. 5 Jan 2016 <http://www.mirror.co.uk/tv/tv-news/simon-cowell-returns-x-factor-2935811>.Gamson, Joshua. “Reality Queens.” Contexts (Meditations) 12.2 (2013): 52-54. Good Will Hunting. Directed by Gus Van Sant. Laurence Bender Productions, 1998. Grodin, Jean. “Play, Festival, and Ritual in Gadamer: On the Theme of the Immemorial in His Later Works.” Language and Linguisticality in Gadamer’s Hermeneutics. Trans. Ed. Lawrence K. Schmidt. Maryland: Lexington Books, 2001. 43-50. Hamilton, Peter. “The Unreal Rise of Reality Television.” Huffington Post Entertainment 25 Sep. 2013. 5 Jun. 2015 <http://www.documentarytelevision.com/commissioning-process/the-unreal-rise-of-reality-television/ Page>. Hill, Annette. Reality TV: Audiences and Popular Factual Television. Oxon: Routledge, 2005. Hirschorn, Michael. “The Case for Reality TV: What the Snobs Don’t Understand.” The Atlantic May 2007. 16 April 2015 <http://www.theatlantic.com/magazine/archive/2007/05/the-case-for-reality-tv/305791/>. I Am Cait. Bunim Murray Productions and E! Entertainment. 26 Jul. 2015. The Karate Kid. Directed by John G. Avilsden. Columbia Pictures, 1984. Krätke, Stefan. “‘Creative Cities’ and the Rise of the Dealer Class: A Critique of Richard Florida’s Approach to Urban Theory.” International Journal of Urban and Regional Research 34 (2010): 835-53. Mad Men. Matthew Weiner. Weiner Bros. 19 Jul. 2007. Maslin, Janet. “Good Will Hunting (1997) FILM REVIEW; Logarithms and Biorhythms Test a Young Janitor.” New York Times 5 Dec. 1997.Marche, Stephen. “How Much Do We Owe Simon Cowell?” Esquire.com 11 Jan. 2010. 7 Feb. 2016 <http://www.esquire.com/news-politics/a6899/simon-cowell-leaving-american-idol-0110/>. Marikar, Sheila. “Bald and Broken: Inside Britney’s Shaved Head.” American Broadcasting Corporation 19 Feb. 2007. 13 Apr. 2016 <http://abcnews.go.com/Entertainment/Health/story?id=2885048>.Nair, Drishya. “Britney Spears to Join X Factor for $15 Million to Be the Highest Paid Judge Ever? Other Highly Paid Judges in Reality Shows.” International Business Times 12 Apr. 2012. 7 Feb. 2016 <http://www.ibtimes.com/britney-spears-join-x-factor-15-million-be-highest-paid-judge-ever-other-highly-paid-judges-reality>. New York Daily News. “Reality Bites: 'American Idol' Judges, Especially Ellen, Overly Praise Tim Urban for 'Hallelujah'.” New York Daily News 12 Mar. 2010. 11 April 2016 <http://www.nydailynews.com/entertainment/tv-movies/reality-bites-american-idol-judges-ellen-overly-praise-tim-urban-hallelujah-article-1.176978>. Orbe, Mark. “Representations of Race in Reality TV: Watch and Discuss.” Critical Studies in Media Communication 25.4 (2008) 345-52. Papacharissi, Zizi, and Andrew L. Mendelson. “Exploratory Study of Reality Appeal: Uses and Gratifications of Reality Shows.” Journal of Broadcasting and Electronic Media 51.2 (2007): 355-70. Pavia, Lucy. “Kardashian Net Worth: How Much Money Do They All Have Individually?” Instyle.co.uk 4 Dec. 2015. 6 Jan. 2016 <http://www.instyle.co.uk/celebrity/news/the-kardashian-rich-list-what-are-they-all-worth-individually#XkRy3pjE5mo1sxfG.99>.Pesce, Nicole. “Jenner's Gold! Caitlyn 'Could Be Worth over $500 Million' in Coming Years.” New York Daily News 3 June 2015. 6 Jan. 2016 <http://www.nydailynews.com/entertainment/gossip/caitlyn-jenner-richer-kardashians-experts-article-1.2244402>.Peyser, Marc. “AMERICAN IDOL.” Newsweek 13 Dec. 2008. 5 Jan. 2016 <http://europe.newsweek.com/american-idol-82867?rm=eu>.Pinter, Harold. “Art, Truth & Politics". Nobelprize.org. Nobel Lecture. Stockholm: Nobel Media AB, 2014. 13 Apr 2016 <http://www.nobelprize.org/nobel_prizes/literature/laureates/2005/pinter-lecture-e.html>. “Reality Show Fights.” American Broadcasting Corporation 30 Mar. 2011. 24 July 2014 <https://www.youtube.com/watch?v=X8bhnTfxWz8>.“Reality Writer.” WGAW Writer’s Guild of America West, n.d. 25 April 2014 <http://www.wga.org/organizesub.aspx?id=1092>. Runco, Mark A. “Everyone Has Creative Potential.” Creativity: From Potential to Realization. Washington DC: American Psychological Association, 2004. 21-30. ———. “Creativity.” Annual Review Psychology 55 (2004): 657–87. Rupel, David. “How Reality TV Works.” WGAW Writer’s Guild of America West, n.d. 15 May 2014 <http://www.wga.org/organizesub.aspx?id=1091>.Sender, Katherine. “Real Worlds: Migrating Genres, Travelling Participants, Shifting Theories.” The Politics of Reality Television: Global Perspectives. Eds. Marwan M. Kraidy and Katherine Sender. New York: Routledge, 2011. 1-13. Skeggs, Beverly, and Helen Wood. Reacting to Reality Television: Performance, Audience and Value. New York: Routledge, 2012. Stradal, Ryan. J. “Unscripted Does Not Mean Unwritten.” WGAW Writer’s Guild of America West, n.d. 15 May 2014 <http://www.wga.org/organizesub.aspx?id=1096>. Schroeder E.R. “‘Sexual Racism’ and Reality Television: Privileging the White Male Prerogative on MTV’s The Real World: Philadelphia.” How Real Is Reality TV?: Essays on Representation and Truth. Ed. D.S. Escoffery. Jefferson, NC: McFarland, 2006. 180–94. Schuster, Dana. “Dying for Fame: 21 Reality Stars Committed Suicide in a Decade.” New York Post 28 Feb. 2016. 11 April 2016 <http://nypost.com/2016/02/28/dying-for-fame-21-reality-stars-commit-suicide-in-past-decade/>.The X Factor (UK). TV show. ITV 4 Sep. 2004 to present. Thompson, Bronwyn. “FAST TRACK TO THE FINAL 12.” Fox 8 TV, 2015. 11 Apr. 2016 <http://www.fox8.tv/shows/australias-next-top-model/show/news>. Vogler, Chris. The Writer’s Journey: Mythic Structure for Writers. 3rd ed. Studio City: Michael Wiese Productions, 2007.West, Latoya. “INTERVIEW: Top Model's Tiffany Talks about Being Yelled At by Tyra Banks.” About Entertainment: Reality TV. 20 Feb. 2016. 13 Apr. 2016 <http://realitytv.about.com/od/thelatestinterviews/a/TiffanyChat.htm>. Winant, Gabriel. “Dirty Jobs, Done Dirt Cheap: Working in Reality Television.” New Labor Forum 23.3 (2014): 66-71. Woodward, Gary C. “Is Mentoring Out of Fashion?” The Perfect Response 6 Mar. 2015. 11 Apr. 2016 <https://theperfectresponse.pages.tcnj.edu/2015/03/06/is-mentoring-out-of-fashion/>. Wyatt, Daisy. “I Am Cait: Caitlyn Jenner 'Paid a Record-Breaking $5 Million' for E! Reality TV Show.” Independent 12 June 2015. 5 Feb. 2016 <http://www.independent.co.uk/arts-entertainment/tv/news/caitlyn-jenner-paid-record-5m-to-front-e-reality-tv-show-i-am-cait-10315826.html>. “‘X Factor’ UK 2015 Dark Secrets: ‘Horrific’ & Like ‘Prison’ Says Contestant.” Australia Network News 19 Nov. 2015. 1 Nov. 2015 <http://www.australianetworknews.com/x-factor-uk-2015-dark-secrets-horrific-like-prison-says-contestant/>.

46

Brabazon, Tara. "Black and Grey." M/C Journal 6, no.2 (April1, 2003). http://dx.doi.org/10.5204/mcj.2165.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Troubled visions of white ash and concrete-grey powder water-logged my mind. Just as I had ‘understood’ and ‘contextualised’ the events of September 11, I witnessed Jules and Gedeon Naudet’s 9/11, the documentary of the events, as they followed the firefighters into Tower One. Their cameras witness death, dense panic and ashen fear. I did not need to see this – it was too intimate and shocking. But it was the drained, grey visage – where the New York streets and people appeared like injured ghosts walking through the falling ruins of a paper mill – that will always stay with me. Not surprisingly I was drawn (safely?) back in time, away from the grey-stained New York streets, when another series of images seismically shifted by memory palate. Aberfan was the archetypal coal mining town, but what made it distinct was tragedy. On the hill above the village, coal waste from the mining process was dumped on water-filled slurry. Heavy rain on October 20, 1966 made way for a better day to follow. The dense rain dislodged the coal tip, and at 9:15, the slurry became a black tidal wave, overwhelming people and buildings in the past. There have been worse tragedies than Aberfan, if there are degrees of suffering. In the stark grey iconography of September 11, there was an odd photocopy of Aberfan, but in the negative. Coal replaced paper. My short piece explores the notion of shared tragedy and media-ted grief, utilising the Welsh mining disaster as a bloodied gauze through which to theorise collective memory and social change. Tragedy on the television A disaster, by definition, is a tragic, unexpected circ*mstance. Its etymology ties it to astrology and fate. Too often, free flowing emotions of sympathy dissipate with the initial fascination, without confronting the long-term consequences of misfortune. When coal slurry engulfed the school and houses in Aberfan, a small working class community gleaned attention from the London-based media. The Prime Minister and royalty all traveled to Aberfan. Through the medium of television, grief and confusion were conveyed to a viewing public. For the first time, cameras gathered live footage of the trauma as it overwhelmed the Taff Valley. The sludge propelled from the Valley and into the newspapers of the day. A rescue worker remembers, “I was helping to dig the children out when I heard a photographer tell a kiddie to cry for her dear friends, so that he could get a good picture – that taught me silence.” (“The last day before half-term.”) Similarly, a bereaved father remembers that, during that period the only thing I didn’t like was the press. If you told them something, when the paper came out your words were all the wrong way round. (“The last day before half-term.”) When analyzed as a whole, the concerns of the journalists – about intense emotion and (alternatively) censorship of emotion - blocked a discussion of the reasons and meaning of the tragedy, instead concentrating on the form of the news broadcasts. Debates about censorship and journalistic ethics prevented an interpretative, critical investigation of the disaster. The events in Aberfan were not created by a natural catastrophe or an unpredictable or blameless ‘act of God.’ Aberfan’s disaster was preventable, but it became explainable within a coal industry village accustomed to unemployment and work-related ‘accidents.’ Aberfan was not merely a disaster that cost life. It represented a two-fold decline of Britain: industrially and socially. Coal built the industrial matrix of Britain. Perhaps this cost has created what Dean MacCannell described as “the collective guilt of modernised people” (23). Aberfan was distinct from the other great national tragedies in the manner the public perceived the events unfolding in the village. It was the disaster where cameras recorded the unerring screams of grief, the desperate search for a lost – presumed dead – child, and the building anger of a community suffering through a completely preventable ‘accident.’ The cameras – in true A Current Affair style – intruded on grief and privacy. A bereaved father stated that “I’ve got to say this again, if the papers and the press and the television were to leave us alone in the very beginning I think we could have settled down a lot quicker than what we did” (“The last day before half-term.”). This breach of grieving space also allowed those outside the community to share a memory, create a unifying historical bond, and raised some sympathy-triggered money. To actually ‘share’ death and grief at Aberfan through the medium of television led to a reappraisal, however temporary, about the value and costs of industrialisation. The long-term consequences of these revelations are more difficult to monitor. A question I have always asked – and the events of September 11, Bali and the second Gulf War have not helped me – is if a community or nation personally untouched by tragic events experience grief. Sympathy and perhaps empathy are obvious, as is voyeurism and curiosity. But when the bodies are simply unidentified corpses and a saddened community as indistinguishable from any other town, then viewers needs to ponder the rationale and depth of personal feelings. Through the window of television, onlookers become Peeping Toms, perhaps saturated with sympathy and tears, but still Peeping Toms. How has this semiotic synergy continued through popular memory? Too often we sap the feelings of disasters at a distance, and then withdraw when it is no longer fashionable, relevant or in the news. Notions about Wales, the working class and coal mining communities existed in journalists’ minds before they arrived in the village, opened their notebook or spoke to camera. They mobilised ‘the facts’ that suited a pre-existing interpretation. Bereaved parents digging into the dirt for lost children, provide great photographs and footage. This material was ideologically shaped to infantilise the community of Aberfan and, indirectly, the working class. They were exoticised and othered. It is clear from testimony recorded since the event that the pain felt by parents was compounded by television and newspaper reportage. Television allowed “a collective witnessing” (McLean and Johnes, “Remembering Aberfan”) of the disaster. Whether these televisual bystanders actually contributed anything to the healing of the tragedy, or forged an understanding of the brutal work involved in extracting coal, is less clear. There is not a natural, intrinsic sense of community created through television. Actually, it can establish boundaries of difference. Television has provided a record of exploitation, dissent and struggle. Whether an event or programme is read as an expression of unequal power relations or justifiable treatment of the ‘unworthy poor’ is in the hands of the viewer. Class-based inequalities and consciousness are not blinked out with the operation of a remote control. Intervention When I first researched Aberfan in the 1980s, the story was patchy and incomplete. The initial events left journalistic traces of the horror and – later – boredom with the Aberfan tragedy. Because of the thirty year rule on the release of government documents, the cause, motivation and rationale of many decisions from the Aberfan disaster appeared illogical or without context. When searching for new material and interpretations on Aberfan between 1968 and 1996, little exists. The release of documents in January 1997 triggered a wave of changing interpretations. Two committed and outstanding scholars, upon the release of governmental materials, uncovered the excesses and inequalities, demonstrating how historical research can overcome past injustice, and the necessity for recompense in the present. Iain McLean and Martin Johnes claimed a media profile and role in influencing public opinion and changing the earlier interpretations of the tragedy. On BBC radio, Professor McLean stated I think people in the government, people in the Coal Board were extremely insensitive. They treated the people of Aberfan as trouble makers. They had no conception of the depth of trauma suffered (“Aberfan”). McLean and Johnes also created from 1997-2001 a remarkable, well structured and comprehensive website featuring interview material, a database of archival collections and interpretations of the newly-released governmental documents. The Website possessed an agenda of conservation, cataloguing the sources held at the Merthyr Tydfil and Dowlais libraries. These documents hold a crucial function: to ensure that the community of Aberfan is rarely bothered for interviews or morbid tourists returning to the site. The Aberfan disaster has been included in the UK School curriculum and to avoid the small libraries and the Community Centre being overstretched, the Website possesses a gatekeepping function. The cataloguing work by the project’s research officer Martin Johnes has produced something important. He has aligned scholarly, political and social goals with care and success. Iain McLean’s proactive political work also took another direction. While the new governmental papers were released in January 1997, he wrote an article based on the Press Preview of December 1996. This article appeared in The Observer on January 5, 1997. From this strong and timely intervention, The Times Higher Education Supplement commissioned another article on January 17, 1997. Through both the articles and the Web work, McLean and Johnes did not name the individual victims or their parents, and testimony appears anonymously in the Website and their publications. They – unlike the journalists of the time – respected the community of Aberfan, their privacy and their grief. These scholars intervened in the easy ‘sharing’ of the tragedy. They built the first academic study of the Aberfan Disaster, released on the anniversary of the landslide: Aberfan, Government and Disasters. Through this book and their wide-ranging research, it becomes clear that the Labour Government failed to protect the citizens of a safe Labour seat. A bereaved husband and parent stated that I was tormented by the fact that the people I was seeking justice from were my people – a Labour Government, a Labour council, a Labour-nationalised Coal Board (“The last day before half-term”). There is a rationale for this attitude towards the tragedy. The Harold Wilson Labour Governments of 1964-70 were faced with severe balance of payments difficulties. Also, they only held a majority in the house of five, which they were to build to 96 in the 1966 election. While the Welfare State was a construction ‘for’ the working class after the war, the ‘permissive society’ – and resultant social reforms – of the 1960s was ‘for’ middle class consumers. It appeared that the industrial working class was paying for the new white heat of technology. This paradox not only provides a context for the Aberfan disaster but a space for media and cultural studies commentary. Perhaps the most difficult task for those of us working in cultural and media studies is to understand the citizens of history, not only as consumers, spectators or an audience, but how they behave and what they may feel. We need to ask what values and ideas do we share with the ‘audiences,’ ‘citizens’ and ‘spectators’ in our theoretical matrix. At times we do hide behind our Foucaults and Kristevas, our epistemologies and etymology. Raw, jagged emotion is difficult to theorise, and even more complex to commit to the page. To summon any mode of resistive or progressivist politics, requires capturing tone, texture and feeling. This type of writing is hard to achieve from a survey of records. A public intellectual role is rare these days. The conservative media invariably summon pundits with whom they can either agree or pillory. The dissenting intellectual, the diffident voice, is far more difficult to find. Edward Said is one contemporary example. But for every Said, there is a Kissinger. McLean and Johnes, during a time of the Blair Government, reminded a liberal-leaning Labour of earlier mistakes in the handling of a working-class community. In finding origins, causes and effects, the politicisation of history is at its most overt. Path of the slag The coal slurry rolled onto the Welsh village nearly thirty-seven years ago. Aberfan represents more than a symbol of decline or of burgeoning televisual literacy. It demonstrates how we accept mediated death. A ‘disaster’ exposes a moment of insight, a transitory glimpse into other people’s lives. It composes a mobile, dynamic photograph: the viewer is aware that life has existed before the tragedy and will continue after it. The link between popular and collective memory is not as obvious as it appears. All memory is mediated – there is a limit to the sharing. Collective memory seems more organic, connected with an authentic experience of events. Popular memory is not necessarily contextually grounded in social, historical or economic formations but networks diverse times and spaces without an origin or ending. This is a post-authentic memory that is not tethered to the intentions, ideologies or origins of a sender, town or community. To argue that all who have seen photographs or televisual footage of Aberfan ‘share’ an equivalent collective memory to those directly touched by the event, place, family or industry is not only naïve, but initiates a troubling humanism which suggests that we all ‘share’ a common bank of experience. The literacy of tragedy and its reportage was different after October 1966. When reading the historical material from the disaster, it appears that grieving parents are simply devastated puppets lashing out at their puppeteers. Their arguments and interpretation were molded for other agendas. Big business, big government and big unions colluded to displace the voices of citizens (McLean and Johnes “Summary”). Harold Wilson came to office in 1964 with the slogan “13 wasted years.” He promised that – through economic growth – consensus could be established. Affluence through consumer goods was to signal the end of a polarisation between worker and management. These new world symbols, fed by skilled scientific workers and a new ‘technological revolution,’ were – like the industrial revolution – uneven in its application. The Aberfan disaster is situated on the fault line of this transformation. A Welsh working class community seemed out of time and space in 1960s Britain. The scarved women and stocky, strong men appeared to emerge from a different period. The television nation did not share a unified grief, but performed the gulf between England and Wales, centre and periphery, middle and working class, white collar and black collar. Politics saturates television, so that it is no longer possible to see the join. Aberfan’s television coverage is important, because the mend scar was still visible. Literacy in televisual grief was being formed through the event. But if Aberfan did change the ‘national consciousness’ of coal then why did so few southern English citizens support the miners trying to keep open the Welsh pits? The few industries currently operating in this region outside of Cardiff means that the economic clock has stopped. The Beveridge Report in 1943 declared that the great achievement of the Second World War was the sharing of experience, a unity that would achieve victory. The People’s War would create a People’s Peace. Aberfan, mining closures and economic decline destroyed this New Jerusalem. The green and pleasant land was built on black coal. Aberfan is an historical translator of these iconographies. Works Cited Bereaved father. “The last day before half-term.” 1999. 6 April 2003 <http://www.nuff.ox.ac.uk/politics/aberfan/chap1.htm>. Bereaved husband and parent. “The last day before half-term.” 1999. 6 April 2003 <http://www.nuff.ox.ac.uk/politics/aberfan/chap1.htm>. MacCannell, Dean. Empty Meeting Grounds. London: Routledge, 1992. McLean, Iain. “Aberfan.” 6 April 2003 <http://news.bbc.co.uk/olmedia/980000/audio/_983056_mclean_ab... ...erfan_21oct_0800.ram>. McLean, Iain, and Martin Johnes. Aberfan: Government and Disasters. Cardiff: Welsh Academic Press, 2000. McLean, Iain, and Martin Johnes. “Remembering Aberfan.” 1999. 6 April 2003 <http://www.nuff.ox.ac.uk/politics/aberfan/remem.htm>. McLean, Iain, and Martin Johnes. “Summary of Research Results.” 1999. 6 April 2003 <http://www.nuff.ox.ac.uk/politics/aberfan/eoafinal.htm>. Naudet, Jules, Gedeon Naudet, and James Hanlon. 9/11. New York: Goldfish Pictures and Silverstar Productions, 2001. Rescue worker. “The last day before half-term.” 1999. 6 April 2003 <http://www.nuff.ox.ac.uk/politics/aberfan/chap1.htm>. Links http://news.bbc.co.uk/olmedia/980000/audio/_983056_mclean_aberfan_21oct_0800.ram http://www.nuff.ox.ac.uk/politics/aberfan/chap1.htm http://www.nuff.ox.ac.uk/politics/aberfan/chap1.htm.(1999 http://www.nuff.ox.ac.uk/politics/aberfan/eoafinal.htm http://www.nuff.ox.ac.uk/politics/aberfan/home.htm http://www.nuff.ox.ac.uk/politics/aberfan/remem.htm Citation reference for this article Substitute your date of access for Dn Month Year etc... MLA Style Brabazon, Tara. "Black and Grey" M/C: A Journal of Media and Culture< http://www.media-culture.org.au/0304/07-blackandgrey.php>. APA Style Brabazon, T. (2003, Apr 23). Black and Grey. M/C: A Journal of Media and Culture, 6,< http://www.media-culture.org.au/0304/07-blackandgrey.php>

47

Parsemain, Ava Laure. "Crocodile Tears? Authenticity in Televisual Pedagogy." M/C Journal 18, no.1 (January19, 2015). http://dx.doi.org/10.5204/mcj.931.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

This article explores the role of authenticity in televisual teaching and learning based on a case study of Who Do You Think You Are?, a documentary series in which celebrities go on a journey to retrace their family tree. Originally broadcast by the British Broadcasting Corporation, this series has been adapted in eighteen countries, including Australia. The Australian version is produced locally and has been airing on the public channel Special Broadcasting Service (SBS) since 2008. According to its producers, Who Do You Think You Are? teaches history and promotes multiculturalism:We like making a broad range of programs about history and telling our own Australian stories and particularly the multicultural basis of our history […] A lot of people know the broad Australian stroke, English, British history but they don’t really know as much about the migratory history […] It’s a way of saying this is our country now, this is where it came from, here’s some stories, which you might not be aware of, and what’s happened to people along the way. (Producer 1) In this article, I examine Who Do You Think You Are? as an educational text and I investigate its pedagogy. Starting with the assumption that it aims to teach, my intention is to explain how it teaches. In particular, I want to demonstrate that authenticity is a key feature of its pedagogy. Applied to the televisual text, the term “authentic” refers to the quality of being true or based on facts. In this sense, authenticity implies actuality, accuracy and reliability. Applied to media personae, “authentic” must be understood in its more modern sense of “genuine”. From this perspective, to be “authentic” requires displaying “one’s inner truths” (McCarthy 242). Based on my textual analysis and reception study, I show that these two forms of authenticity play a crucial role in the pedagogy of Who Do You Think You Are? Signifying Authenticity One of the pedagogical techniques of Who Do You Think You Are? is to persuade viewers that it authentically represents actual events by using some of the codes and conventions of the documentary. According to Michael Renov, the persuasive modality is intrinsic to all documentary forms and it is linked to their truth claim: “the documentary ‘truth claim’ (which says, at the very least: ‘Believe me, I’m of the world’) is the baseline for persuasion for all of nonfiction, from propaganda to rock doc” (30). Who Do You Think You Are? signifies actuality by using some of the codes and conventions of the observational documentary. As Bill Nichols explains, observational documentaries give the impression that they spontaneously and faithfully record actual events as they happen. Nichols compares this mode of documentary to Italian Neorealism: “we look in on life as it is lived. Social actors engage with one another, ignoring the filmmakers” (111). In Who Do You Think You Are? the celebrities and other social actors often engage with one another without acknowledging the camera’s presence. In those observational scenes, various textual features signify actuality: natural sounds, natural light or shaky hand-held camera, for example, are often used to connote the unprepared recording of reality. This is usually reinforced by the congruence between the duration of the scene and the diegetic time (the duration of the action that is represented). Furthermore, Who Do You Think You Are? emphasises authenticity by showing famous Australians as ordinary people in ordinary settings or doing mundane activities. As one of the SBS programmers pointed out during our interview: “It shows personalities or stars that you can never get to as real people and it makes you realise that those people, actually, they’re the same as you and I!” (SBS programmer). Celebrities are “real” in the sense that they exist in the profilmic world; but in this context showing celebrities “as real people” means showing them as ordinary individuals whom the audience can relate to and identify with. Instead of representing “stars” through their usual manufactured public personae, the program offers glimpses into their real lives and authentic selves, thus giving “backstage access to the famous” (Marwick and boyd 144). In this regard, the series aligns with other media texts, including “celebreality” programs and social networking sites like Twitter, whose appeal lies in the construction of more authentic and intimate presentations of celebrities (Marwick and boyd; Ellcessor; Thomas). This rhetoric of authenticity is enhanced by the celebrity’s genealogical journey, which is depicted both as a quest for historical knowledge and for self-knowledge. Indeed, as its title suggests, the program links ancestry to personal identity. In every episode, the genealogical investigation reveals similarities between the celebrity and their ancestors, thus uncovering personality traits that seem to have been transmitted from generation to generation. Thus, the series does more than simply showing celebrities as ordinary people “stripped of PR artifice and management” (Marwick and boyd 149): by unveiling those transgenerational traits, it discloses innermost aspects of the celebrities’ authentic selves—a backstage beyond the backstage. Who Do You Think You Are? communicates authenticity in these different ways in order to invite viewers’ trust. As Louise Spence and Vinicius Navarro observe, this is characteristic of most documentaries: Whereas fiction films may allude to actual events, documentaries usually claim that those events did take place in such and such a way, and that the images and sounds on the screen are accurate and reliable […] Most documentaries—if not all of them—have something to say about the world and, in one way or another, they want to be trusted by their audience. (Spence and Navarro 13) Similarly, Nichols writes that as documentary viewers, “we uphold our belief in the authenticity of the historical world represented on screen […] we assume that documentary sounds and images have the authenticity of evidence” (36). This is supported by Thomas Austin’s reception study of documentary films in the United Kingdom, which shows that most viewers expect documentaries to give them “access to the real.” According to Austin, these generic expectations about authenticity contribute to the pedagogic authority of documentaries. Therefore, the implied audience (Barker and Austin) of Who Do You Think You Are? must trust that it authentically represents actual events and individuals and they must perceive it as an accurate and reliable source of knowledge about the historical world in order to “attain a meaningful encounter” (48) with it. The implied audience in no way predicts actual audiences’ responses (which I will examine in the remainder of this article) but it is an important aspect of the program’s pedagogy: for the text to be read as a “history lesson” (Nichols 39) viewers must be persuaded by the program’s rhetoric of authenticity. Perceiving Authenticity My reception study confirms that in order to learn, viewers must be persuaded by this rhetoric of authenticity, which promises “information and knowledge, insight and awareness” (Nichols 40). This is illustrated by the responses of five viewers who participated in a screening and focus group discussion. Arya, Marnie, Junior, Lec and Krista all say that they have learnt from Who Do You Think You Are? either at home or from the episode that was screened before our discussion. They all agree that the program teaches about history, multiculturalism and other aspects that were not predicted by the producers (such as human nature, relationships and social issues). More importantly, these viewers learn from the program because they trust that it authentically represents actual events and because they perceive the personae as “natural”, “relaxed” and “being themselves” and their emotions as “genuine”: Krista: It felt genuine to me.Lec: Me also […]Marnie: I felt like he seemed more natural, even with the interpreter there, talking with his aunty. He seemed more himself, he was more emotional […]Arya: I don’t think that they’re acting. To go outside of this session, I mean, I’ve seen the show before and I think it is really genuine. As Austin notes, what matters from the viewers’ perspective is not “the critically scrutinised indexical guarantee of documentary, but rather a less well defined and nebulous sense of qualities such as the 'humanity', 'honesty', 'sincerity'.” This does not mean that viewers naively believe that the text gives a transparent, unmediated access to the truth (Austin). Trust (or in Austin’s words “willing abandonment”) can be combined with scepticism (Buckingham; Ang; Liebes and Katz). Marnie, for example, oscillates between these two modalities of response: Marnie: If something seems quite artificial, it stands out, you start thinking about well, why did they do that? But while they’re just sitting down, having a conversation, there’s not anything really that you have to think about. Obviously all those transition shots, sitting on the rock, opening a letter in the square, they also have, you know, the violins playing and everything. Everything builds to feel a bit more contrived, whereas when they’re having the conversation, I wasn’t aware of the music. Maybe I was listening to what they were saying more. But I think you sort of engage a bit more in listening to what they’re saying when they’re having a conversation. Whereas the filling, you’re not really thinking about his emotions so much as…why is he wearing that shirt? Interestingly, the scenes that Marnie perceives as authentic and that she engages with are the “conversations” scenes, which use the codes and conventions of the observational documentary. The scenes that she views with scepticism are the more dramatised sequences, which do not use the codes and conventions of the observational documentary. Marnie is the only viewer in my focus groups who clearly oscillates between trust and scepticism. She is also the most ambivalent about what she has learnt and about the quality of the knowledge that she gains from Who Do You Think You Are? Authenticity and Emotional Responses Because they believe that the personae and emotions in the program are genuine, these viewers are emotionally engaged. As the producers explain, learning from Who Do You Think You Are? is not a purely cognitive process but is fundamentally an emotional and empathetic experience: There are lots of programs on television where you can learn about history. I think what’s so powerful about this show is because it has a very strong emotional arc […] You can learn a lot of dates, and you can pass a test, just on knowing the year that the Blue Mountains were first crossed or the Magna Carta was signed. But what Who Do You Think You Are? does is that it takes you on a journey where you get to really feel the experiences of those people who were fighting the battle or climbing the mast. (Producer 2) The producers invite viewer empathy in two ways: they design the program so that viewers are encouraged to share the emotions of people who lived in the past; and they design it so that viewers are encouraged to share the emotions of the celebrities who participate in the program. This is illustrated by the participants’ responses to one scene in which the actor Don Hany sees an old photograph of his pregnant mother: Lec: I was touched! I was like “aw!”Ms Goldblum: I didn’t buy it.Krista: You didn’t feel like that, Lec?Lec: Not at all! Like, yeah, I got a bit touched.Junior: Yeah. And those looked like genuine tears, they weren’t crocodile tears.Ms Goldblum: I didn’t think so. There was a [sniffing], pause, pose, camera moment.Junior: I had a little moment…Krista: Aw!Interviewer: You had a moment?Junior: Yeah, there was a little moment there.Ms Goldblum: Got a little teary?Junior: When he’s looking at the photos, yeah. Because I think everyone’s done that, gone back and looked through old photos, you know what that feeling is. As this discussion suggests, authenticity is a crucial aspect of the program’s pedagogy, not only because the viewers must trust it in order to learn from it, but also because it facilitates empathy and emotional engagement. Distrust and Cynicism In contrast, the viewers who do not learn from Who Do You Think You Are? perceive the program as contrived and the celebrity’s emotions as inauthentic: Wolfgang: I don’t think they taught me much that I didn’t already know in regards to history.Naomi: Yeah, me neither […] I kind of look at these shows and think it’s a bit contrived […]Wolfgang: I hate all that. They’re constructing a show purely for money, that’s all bullsh*t. That annoys me […]Ms Goldblum: But for me the show is just about, I don’t know, they try to find something to be sentimental and it’s not. Like, they try to force it […] I didn’t buy it […] Because they are aware of the constructed nature of the program and because they perceive it as contrived, these viewers do not engage emotionally with the content: Naomi: When I see someone on this show looking at photos, I find it really difficult to stop thinking he’s got a camera on his face.Wolfgang: Yeah.Naomi: He’s looking at photos, and that’s a beautiful moment, but there’s a camera right there, looking at him, and I can’t help but think that when I see those things […] There are other people in the room that we don’t see and there’s a camera that’s pointing at him […] This intellectual distance is sometimes expressed through mockery and laughter (Buckingham). Because they distrust the program and make fun of it, Wolfgang and Ms Goldblum (who were not in the same focus group) are both described as “cynics”: Ms Goldblum: He gets all teary and I think oh he’s an actor he’s just putting that sh*t on, trying to make it look interesting. Whereas if it were just a normal person, I’d find it more believable. But I think the whole premise of the show is they take famous people, like actors and all those people in the spotlight, I think because they put on good shows. I would be more interested in someone who wasn’t famous. I’d find it more genuine.Junior: You are such a cynic! […]Wolfgang: And look, maybe I’m a big cynic about this, and that’s why I haven’t watched it. But it’s this emotionally padded, scripted, prompted kind of thing, which makes it more palatable for people to watch. Unlike most participants, who identify the program as “educational” and “documentary”, Wolfgang classifies it as pure entertainment. His cynicism and scepticism can be linked to his generic labelling of the program as “reality TV”: Wolfgang: I don’t watch commercial TV, I can’t stand it. And it’s for that reason. It’s all contrived. It’s all based on selling something as opposed to looking into this guy’s family and history and perhaps learning something from it. Like, it’s entertainment, it’s not educational […] It’s a reality TV sort of thing, I just got no interest in it really. As Annette Hill shows in her reception study of the reality game program Big Brother, most viewers are cynical about the authenticity of reality television. Despite the generic label of “reality”, most interpret reality programs as inauthentic. Indeed, as John Corner points out, reality television is characterised by display and performance, even though it adopts some of the codes and conventions of the documentary. Hill’s research also reveals that viewers often look for moments of authenticity within the unreal context of reality television: “the ‘game’ is to find the ‘truth’ in the spectacle/performance environment” (337). Interestingly, this describes Naomi and Wolfgang’s attitude towards Who Do You Think You Are?: Naomi: The conversation with his mum seemed a bit more relaxed, maybe. Or a bit more...I don’t know, I kind of look at these shows and think it’s a bit contrived. Whereas that seemed a bit more natural […]Wolfgang: Often he’s just sitting there and I suppose those are filling shots. But I found that when he was chatting to his aunty and seeing the photos that he hadn’t seen before, when he was a child, he was tearing up […] That’s probably the one time I didn’t notice, like, didn’t think about the cameras because I found it quite powerful, when he was tearing up, that was a kind of an emotional moment. According to Austin, viewers’ discourses about authenticity in relation to documentaries and reality television serve as markers of cultural distinction: Often underpinning expressions of the appeal of 'the real', the use of a discourse of authenticity frequently revealed taste markers and a set of cultural distinctions deployed by these cinemagoers, notably between the veracity and 'honesty' of Etre et Avoir [a French documentary] and the contrasting 'fakery' and 'inauthenticity' of reality television. Describing documentaries as authentic and educational and reality television as fake entertainment can be a way for some (middle-class) viewers to assert their socio-cultural status. By performing as the sceptical and cynical viewer and criticising lower cultural forms, research participants distinguish themselves from the imagined mass of unsophisticated and uneducated (working class?) viewers (Buckingham; Austin). Conclusion Some scholars suggest that viewers learn when they compare what they watch on television to their own experiences or when they identify with television characters or personae (Noble and Noble; Tulloch and Lupton; Tulloch and Moran; Buckingham and Bragg). My study contributes to this field of inquiry by showing that viewers learn when they perceive televisual content as authentic and as a reliable source of knowledge. More importantly, the results reveal how some televisual texts signify authenticity to invite trust and learning. This study raises questions about the role of trust and authenticity in televisual learning and it would be fruitful to pursue further research to determine whether these findings apply to genres that are not factual. Examining the production, textual features and reception of fictional programs to understand how they convey authenticity and how this sense of truthfulness influences viewers’ learning would be useful to draw more general conclusions about televisual pedagogy, and perhaps more broadly about the role of trust and authenticity in education. References Ang, Ien. Watching Dallas: Soap Opera and the Melodramatic Imagination. London: Methuen, 1985. Austin, Thomas. "Seeing, Feeling, Knowing: A Case Study of Audience Perspectives on Screen Documentary." Participations 2.1 (2005). 20 Nov. 2014 ‹http://www.participations.org/volume%202/issue%201/2_01_austin.htm›. Barker, Martin, and Thomas Austin. From Antz to Titanic: Reinventing Film Analysis. London: Pluto Press, 2000. Big Brother. Exec. Prod. John de Mol. Channel 4. 2000. Buckingham, David. Children Talking Television: The Making of Television Literacy. London: The Falmer Press, 1993. Buckingham, David, and Sara Bragg. Young People, Media and Personal Relationships. London: The Independent Television Commission, 2003. Corner, John. "Performing the Real: Documentary Diversions." Television & New Media 3.3 (2002): 255—69. "Don Hany." Who Do You Think You Are? Series 5, Episode 3. SBS. 16 Apr. 2013. Ellcessor, Elizabeth. "Tweeting @feliciaday: Online Social Media, Convergence, and Subcultural Stardom." Cinema Journal 51.2 (2012): 46-66. Hill, Annette. "Big Brother: The Real Audience." Television & New Media 3.3 (2002): 323-40. Liebes, Tamar, and Elihu Katz. The Export of Meaning: Cross-Cultural Readings of Dallas. Cambridge: Polity Press, 1990. Marwick, Alice, and danah boyd. "To See and Be Seen: Celebrity Practice on Twitter." Convergence: The International Journal of Research into New Media Technologies 17.2 (2011): 139-58. McCarthy, E. Doyle. “Emotional Performances as Dramas of Authenticity.” Authenticity in Culture, Self, and Society. Eds. Phillip Vannini & J. Patrick Williams. Farnham: Ashgate Publishing, 2009. 241-55. Nichols, Bill. Introduction to Documentary, Second Edition. Bloomington: Indiana UP, 2001. Noble, Grant, and Elizabeth Noble. "A Study of Teenagers' Uses and Gratifications of the Happy Days Shows." Media Information Australia 11 (1979): 17-24. Producer 1. Personal Interview. 29 Sept. 2013. Producer 2. Personal Interview. 10 Oct. 2013. Renov, Michael. Theorizing Documentary. New York: Routledge, 1993. SBS Programmer. Personal Interview. 22 Nov. 2013. Spence, Louise, and Vinicius Navarro. Crafting Truth: Documentary Form and Meaning. New Brunswick: Rutgers UP, 2011. Thomas, Sarah. "Celebrity in the ‘Twitterverse’: History, Authenticity and the Multiplicity of Stardom Situating the ‘Newness’ of Twitter." Celebrity Studies 5.3 (2014): 242-55. Tulloch, John, and Deborah Lupton. Television, Aids and Risk: A Cultural Studies Approach to Health Communication. Sydney: Allen & Unwin, 1997. Tulloch, John, and Albert Moran. A Country Practice: "Quality Soap". Sydney: Currency Press, 1986. Who Do You Think You Are? Exec. Prod. Alex Graham. BBC. 2004. Who Do You Think You Are? Exec. Prod. Celia Tait. SBS. 2008.

48

Starrs, Bruno. "Hyperlinking History and Illegitimate Imagination: The Historiographic Metafictional E-novel." M/C Journal 17, no.5 (October25, 2014). http://dx.doi.org/10.5204/mcj.866.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

‘Historiographic Metafiction’ (HM) is a literary term first coined by creative writing academic Linda Hutcheon in 1988, and which refers to the postmodern practice of a fiction author inserting imagined--or illegitimate--characters into narratives that are intended to be received as authentic and historically accurate, that is, ostensibly legitimate. Such adventurous and bold authorial strategies frequently result in “novels which are both intensely self-reflexive and yet paradoxically also lay claim to historical events and personages” (Hutcheon, A Poetics 5). They can be so entertaining and engaging that the overtly intertextual, explicitly inventive work of biographical HM can even change the “hegemonic discourse of history” (Nunning 353) for, as Philippa Gregory, the author of HM novel The Other Boleyn Girl (2001), has said regarding this genre of creative writing: “Fiction is about imagined feelings and thoughts. History depends on the outer life. The novel is always about the inner life. Fiction can sometimes do more than history. It can fill the gaps” (University of Sussex). In a way, this article will be filling one of the gaps regarding HM.Forrest Gump (Robert Zemeckis, 1994) is possibly the best known cinematic example of HM, and this film version of the 1986 novel by Winston Groom particularly excels in seamlessly inserting images of a fictional character into verified history, as represented by well-known television newsreel footage. In Zemeckis’s adaptation, gaps were created in the celluloid artefact and filled digitally with images of the actor, Tom Hanks, playing the eponymous role. Words are often deemed less trustworthy than images, however, and fiction is considered particularly unreliable--although there are some exceptions conceded. In addition to Gregory’s novel; Midnight’s Children (1980) by Salman Rushdie; The Name of the Rose (1983) by Umberto Eco; and The Flashman Papers (1969-2005) by George MacDonald Fraser, are three well-known, loved and lauded examples of literary HM, which even if they fail to convince the reader of their bona fides, nevertheless win a place in many hearts. But despite the genre’s popularity, there is nevertheless a conceptual gap in the literary theory of Hutcheon given her (perfectly understandable) inability in 1988 to predict the future of e-publishing. This article will attempt to address that shortcoming by exploring the potential for authors of HM e-novels to use hyperlinks which immediately direct the reader to fact providing webpages such as those available at the website Wikipedia, like a much speedier (and more independent) version of the footnotes in Fraser’s Flashman novels.Of course, as Roland Barthes declared in 1977, “the text is a tissue of quotations drawn from innumerable centres of culture” (146) and, as per any academic work that attempts to contribute to knowledge, a text’s sources--its “quotations”--must be properly identified and acknowledged via checkable references if credibility is to be securely established. Hence, in explaining the way claims to fact in the HM novel can be confirmed by independently published experts on the Internet, this article will also address the problem Hutcheon identifies, in that for many readers the entirety of the HM novel assumes questionable authenticity, that is, the novel’s “meta-fictional self-reflexivity (and intertextuality) renders their claims to historical veracity somewhat problematic, to say the least” ("Historiographic Metafiction: Parody", 3). This article (and the PhD in creative writing I am presently working on at Murdoch University in Perth, Western Australia) will possibly develop the concept of HM to a new level: one at which the Internet-connected reader of the hyperlinked e-novel is made fully (and even instantly) aware of those literary elements of the narrative that are legitimate and factual as distinct from those that are fictional, that is, illegitimate. Furthermore, utilising examples from my own (yet-to-be published) hyperlinked HM e-novel, this article demonstrates that such hyperlinking can add an ironic sub-text to a fictional character’s thoughts and utterances, through highlighting the reality concerning their mistaken or naïve beliefs, thus creating HM narratives that serve an entertainingly complex yet nevertheless truly educational purpose.As a relatively new and under-researched genre of historical writing, HM differs dramatically from the better known style of standard historical or biographical narrative, which typically tends to emphasise mimesis, the cataloguing of major “players” in historical events and encyclopaedic accuracy of dates, deaths and places. Instead, HM involves the re-contextualisation of real-life figures from the past, incorporating the lives of entirely (or, as in the case of Gregory’s Mary Boleyn, at least partly) fictitious characters into their generally accepted famous and factual activities, and/or the invention of scenarios that gel realistically--but entertainingly--within a landscape of well-known and well-documented events. As Hutcheon herself states: “The formal linking of history and fiction through the common denominators of intertextuality and narrativity is usually offered not as a reduction, as a shrinking of the scope and value of fiction, but rather as an expansion of these” ("Intertextuality", 11). Similarly, Gregory emphasises the need for authors of HM to extend themselves beyond the encyclopaedic archive: “Archives are not history. The trouble with archives is that the material is often random and atypical. To have history, you have to have a narrative” (University of Sussex). Functionally then, HM is an intertextual narrative genre which serves to communicate to a contemporary audience an expanded story or stories of the past which present an ultimately more self-reflective, personal and unpredictable authorship: it is a distinctly auteurial mode of biographical history writing for it places the postmodern author’s imaginative “signature” front and foremost.Hutcheon later clarified that the quest for historical truth in fiction cannot possibly hold up to the persuasive powers of a master novelist, as per the following rationale: “Fact is discourse-defined: an event is not” ("Historiographic Metafiction", 843). This means, in a rather simplistic nutshell, that the new breed of HM novel writer is not constrained by what others may call fact: s/he knows that the alleged “fact” can be renegotiated and redefined by an inventive discourse. An event, on the other hand, is responsible for too many incontrovertible consequences for it to be contested by her/his mere discourse. So-called facts are much easier for the HM writer to play with than world changing events. This notion was further popularised by Ansgar Nunning when he claimed the overtly explicit work of HM can even change the “hegemonic discourse of history” (353). HM authors can radically alter, it seems, the way the reader perceives the facts of history especially when entertaining, engaging and believable characters are deliberately devised and manipulated into the narrative by the writer. Little wonder, then, that Hutcheon bemoans the unfortunate reality that for many readers the entirety of a HM work assumes questionable “veracity” due to its author’s insertion of imaginary and therefore illegitimate personages.But there is an advantage to be found in this, the digital era, and that is the Internet’s hyperlink. In our ubiquitously networked electronic information age, novels written for publication as e-books may, I propose, include clickable links on the names of actual people and events to Wikipedia entries or the like, thus strengthening the reception of the work as being based on real history (the occasional unreliability of Wikipedia notwithstanding). If picked up for hard copy publication this function of the HM e-novel can be replicated with the inclusion of icons in the printed margins that can be scanned by smartphones or similar gadgets. This small but significant element of the production reinforces the e-novel’s potential status as a new form of HM and addresses Hutcheon’s concern that for HM novels, their imaginative but illegitimate invention of characters “renders their claims to historical veracity somewhat problematic, to say the least” ("Historiographic Metafiction: Parody", 3).Some historic scenarios are so little researched or so misunderstood and discoloured by the muddy waters of time and/or rumour that such hyperlinking will be a boon to HM writers. Where an obscure facet of Australian history is being fictionalised, for example, these edifying hyperlinks can provide additional background information, as Glenda Banks and Martin Andrew might have wished for when they wrote regarding Bank’s Victorian goldfields based HM novel A Respectable Married Woman. This 2012 printed work explores the lives of several under-researched and under-represented minorities, such as settler women and Aboriginal Australians, and the author Banks lamented the dearth of public awareness regarding these peoples. Indeed, HM seems tailor-made for exposing the subaltern lives of those repressed individuals who form the human “backdrop” to the lives of more famous personages. Banks and Andrew explain:To echo the writings of Homi K. Bhaba (1990), this sets up a creative site for interrogating the dominant, hegemonic, ‘normalised’ master narratives about the Victorian goldfields and ‘re-membering’ a marginalised group - the women of the goldfields, the indigenous [sic], the Chinese - and their culture (2013).In my own hyperlinked short story (presently under consideration for publishing elsewhere), which is actually a standalone version of the first chapter of a full-length HM e-novel about Aboriginal Australian activists Eddie Mabo and Chicka Dixon and the history of the Aboriginal Tent Embassy in Canberra, entitled The Bullroarers, I have focussed on a similarly under-represented minority, that being light-complexioned, mixed race Aboriginal Australians. My second novel to deal with Indigenous Australian issues (see Starrs, That Blackfella Bloodsucka Dance), it is my first attempt at writing HM. Hopefully avoiding overkill whilst alerting readers to those Wikipedia pages with relevance to the narrative theme of non-Indigenous attitudes towards light-complexioned Indigenous Australians, I have inserted a total of only six hyperlinks in this 2200-word piece, plus the explanatory foreword stating: “Note, except where they are well-known place names or are indicated as factual by the insertion of Internet hyperlinks verifying such, all persons, organisations, businesses and places named in this text are entirely fictitious.”The hyperlinks in my short story all take the reader not to stubs but to well-established Wikipedia pages, and provide for the uninformed audience the following near-unassailable facts (i.e. events):The TV program, A Current Affair, which the racist character of the short story taken from The Bullroarers, Mrs Poulter, relies on for her prejudicial opinions linking Aborigines with the dealing of illegal drugs, is a long-running, prime-time Channel Nine production. Of particular relevance in the Wikipedia entry is the comment: “Like its main rival broadcast on the Seven Network, Today Tonight, A Current Affair is often considered by media critics and the public at large to use sensationalist journalism” (Wikipedia, “A Current Affair”).The Aboriginal Tent Embassy, located on the lawns opposite the Old Parliament House in Canberra, was established in 1972 and ever since has been the focus of Aboriginal Australian land rights activism and political agitation. In 1995 the Australian Register of the National Estate listed it as the only Aboriginal site in Australia that is recognised nationally for representing Aboriginal and Torres Strait Islander people and their political struggles (Wikipedia, “The Aboriginal Tent Embassy”).In 1992, during an Aboriginal land rights case known as Mabo, the High Court of Australia issued a judgment constituting a direct overturning of terra nullius, which is a Latin term meaning “land belonging to no one”, and which had previously formed the legal rationale and justification for the British invasion and colonisation of Aboriginal Australia (Wikipedia, “Terra Nullius”).Aboriginal rights activist and Torres Strait Islander, Eddie Koiki Mabo (1936 to 1992), was instrumental in the High Court decision to overturn the doctrine of terra nullius in 1992. In that same year, Eddie Mabo was posthumously awarded the Australian Human Rights Medal in the Human Rights and Equal Opportunity Commission Awards (Wikipedia, “Eddie Mabo”).The full name of what Mrs Poulter blithely refers to as “the Department of Families and that” is the Australian Government’s Department of Families, Housing, Community Services and Indigenous Affairs (Wikipedia, “The Department of Families, Housing, Community Services and Indigenous Affairs”).The British colonisation of Australia was a bloody, murderous affair: “continuous Aboriginal resistance for well over a century belies the ‘myth’ of peaceful settlement in Australia. Settlers in turn often reacted to Aboriginal resistance with great violence, resulting in numerous indiscriminate massacres by whites of Aboriginal men, women and children” (Wikipedia, “History of Australia (1788 - 1850)”).Basically, what is not evidenced empirically with regard to the subject matter of my text, that is, the egregious attitudes of non-Indigenous Australians towards Indigenous Australians, can be extrapolated thanks to the hyperlinks. This resonates strongly with Linda Tuhiwai Smith’s assertion in 2012 that those under-represented by mainstream, patriarchal epistemologies need to be engaged in acts of “reclaiming, reformulating and reconstituting” (143) so as to be re-presented as authentic identities in these HM artefacts of literary research.Exerting auteurial power as an Aboriginal Australian author myself, I have sought to imprint on my writing a multi-levelled signature pertaining to my people’s under-representation: there is not just the text I have created but another level to be considered by the reader, that being my careful choice of Wikipedia pages to hyperlink certain aspects of the creative writing to. These electronic footnotes serve as politically charged acts of “reclaiming, reformulating and reconstituting” Aboriginal Australian history, to reuse the words of Smith, for when we Aboriginal Australian authors reiterate, when we subjugated savages wrestle the keyboard away from the colonising overseers, our readers witness the Other writing back, critically. As I have stated previously (see Starrs, "Writing"), receivers of our words see the distorted and silencing master discourse subverted and, indeed, inverted. Our audiences are subjectively repositioned to see the British Crown as the monster. The previously presumed rational, enlightened and civil coloniser is instead depicted as the author and perpetrator of a violently racist, criminal discourse, until, eventually, s/he is ultimately eroded and made into the Other: s/he is rendered the villainous, predatory savage by the auteurial signatures in revisionist histories such as The Bullroarers.Whilst the benefit in these hyperlinks as electronic educational footnotes in my short story is fairly obvious, what may not be so obvious is the ironic commentary they can make, when read in conjunction with the rest of The Bullroarers. Although one must reluctantly agree with Wayne C. Booth’s comment in his classic 1974 study A Rhetoric of Irony that, in some regards, “the very spirit and value [of irony] are violated by the effort to be clear about it” (ix), I will nevertheless strive for clarity and understanding by utilizing Booth’s definition of irony “as something that under-mines clarities, opens up vistas of chaos, and either liberates by destroying all dogmas or destroys by revealing the inescapable canker of negation at the heart of every affirmation” (ix). The reader of The Bullroarers is not expecting the main character, Mrs Poulter, to be the subject of erosive criticism that destroys her “dogmas” about Aboriginal Australians--certainly not so early in the narrative when it is unclear if she is or is not the protagonist of the story--and yet that’s exactly what the hyperlinks do. They expose her as hopelessly unreliable, laughably misinformed and yes, unforgivably stupid. They reveal the illegitimacy of her beliefs. Perhaps the most personally excoriating of these revelations is provided by the link to the Wikipedia entry on the Australian Government’s Department of Families, Housing, Community Services and Indigenous Affairs, which is where her own daughter, Roxy, works, but which Mrs Poulter knows, gormlessly, as “the Department of Families and that”. The ignorant woman spouts racist diatribes against Aboriginal Australians without even realising how inextricably linked she and her family, who live at the deliberately named Boomerang Crescent, really are. Therein lies the irony I am trying to create with my use of hyperlinks: an independent, expert adjudication reveals my character, Mrs Poulter, and her opinions, are hiding an “inescapable canker of negation at the heart of every affirmation” (Booth ix), despite the air of easy confidence she projects.Is the novel-reading public ready for these HM hyperlinked e-novels and their potentially ironic sub-texts? Indeed, the question must be asked: can the e-book ever compete with the tactile sensations a finely crafted, perfectly bound hardcover publication provides? Perhaps, if the economics of book buying comes into consideration. E-novels are cheap to publish and cheap to purchase, hence they are becoming hugely popular with the book buying public. Writes Mark co*ker, the founder of Smashwords, a successful online publisher and distributor of e-books: “We incorporated in 2007, and we officially launched the business in May 2008. In our first year, we published 140 books from 90 authors. Our catalog reached 6,000 books in 2009, 28,800 in 2010, 92,000 in 2011, 191,000 in 2012 and as of this writing (November 2013) stands at over 250,000 titles” (co*ker 2013). co*ker divulged more about his company’s success in an interview with Forbes online magazine: “‘It costs essentially the same to pump 10,000 new books a month through our network as it will cost to do 100,000 a month,’ he reasons. Smashwords book retails, on average, for just above $3; 15,000 titles are free” (Colao 2012).In such a burgeoning environment of technological progress in publishing I am tempted to say that yes, the time of the hyperlinked e-novel has come, and to even predict that HM will be a big part of this new wave of postmodern literature. The hyperlinked HM e-novel’s strategy invites the reader to reflect on the legitimacy and illegitimacy of different forms of narrative, possibly concluding, thanks to ironic electronic footnoting, that not all the novel’s characters and their commentary are to be trusted. Perhaps my HM e-novel will, with its untrustworthy Mrs Poulter and its little-known history of the Aboriginal Tent Embassy addressed by gap-filling hyperlinks, establish a legitimising narrative for a people who have traditionally in white Australian society been deemed the Other and illegitimate. Perhaps The Bullroarers will someday alter attitudes of non-Indigenous Australians to the history and political activities of this country’s first peoples, to the point even, that as Nunning warns, we witness a change in the “hegemonic discourse of history” (353). If that happens we must be thankful for our Internet-enabled information age and its concomitant possibilities for hyperlinked e-publications, for technology may be separated from the world of art, but it can nevertheless be effectively used to recreate, enhance and access that world, to the extent texts previously considered illegitimate achieve authenticity and veracity.ReferencesBanks, Glenda. A Respectable Married Woman. Melbourne: Lacuna, 2012.Banks, Glenda, and Martin Andrew. “Populating a Historical Novel: A Case Study of a Practice-led Research Approach to Historiographic Metafiction.” Bukker Tillibul 7 (2013). 19 Sep. 2014 ‹http://bukkertillibul.net/Text.html?VOL=7&INDEX=2›.Barthes, Roland. Image, Music, Text. Trans. Stephen Heath. London: Fontana Press, 1977.Booth, Wayne C. A Rhetoric of Irony. Chicago: U of Chicago P, 1974.Colao, J.J. “Apple’s Biggest (Unknown) Supplier of E-books.” Forbes 7 June 2012. 19 Sep. 2014 ‹http://www.forbes.com/sites/jjcolao/2012/06/07/apples-biggest-unknown-supplier-of-e-books/›.co*ker, Mark. “Q & A with Smashwords Founder, Mark co*ker.” About Smashwords 2013. 19 Sep. 2014 ‹https://www.smashwords.com/about›.Eco, Umberto. The Name of the Rose. Trans. William Weaver, San Diego: Harcourt, 1983.Forrest Gump. Dir. Robert Zemeckis. Paramount Pictures, 1994.Fraser, George MacDonald. The Flashman Papers. Various publishers, 1969-2005.Groom, Winston. Forrest Gump. NY: Doubleday, 1986.Gregory, Philippa. The Other Boleyn Girl. UK: Scribner, 2001.Hutcheon, Linda. A Poetics of Postmodernism: History, Theory, Fiction, 2nd ed. Abingdon, UK: Taylor and Francis, 1988.---. “Intertextuality, Parody, and the Discourses of History: A Poetics of Postmodernism History, Theory, Fiction.” 1988. 19 Sep. 2014 ‹http://ieas.unideb.hu/admin/file_3553.pdf›.---. “Historiographic Metafiction: Parody and the Intertextuality of History.” Eds. P. O’Donnell and R.C. Davis, Intertextuality and Contemporary American Fiction. Baltimore, Maryland: John Hopkins UP, 1989. 3-32.---. “Historiographic Metafiction.” Ed. Michael McKeon, Theory of the Novel: A Historical Approach Baltimore, Maryland: Johns Hopkins UP, 2000. 830-50.Nunning, Ansgar. “Where Historiographic Metafiction and Narratology Meet.” Style 38.3 (2004): 352-75.Rushdie, Salman. Midnight’s Children. London: Jonathan Cape, 1980.Starrs, D. Bruno. That Blackfella Bloodsucka Dance! Saarbrücken, Germany: Just Fiction Edition (paperback), 2011; Starrs via Smashwords (e-book), 2012.---. “Writing Indigenous Vampires: Aboriginal Gothic or Aboriginal Fantastic?” M/C Journal 17.4 (2014). 19 Sep. 2014 ‹http://journal.media-culture.org.au/index.php/mcjournal/article/viewArticle/834›.Tuhiwai Smith, Linda. Decolonizing Methodologies. London & New York: Zed Books, 2012.University of Sussex. “Philippa Gregory Fills the Historical Gaps.” University of Sussex Alumni Magazine 51 (2012). 19 Sep. 2014 ‹http://www.scribd.com/doc/136033913/University-of-Sussex-Alumni-Magazine-Falmer-issue-51›.Wikipedia. “A Current Affair.” 2014. 19 Sep. 2014 ‹http://en.wikipedia.org/wiki/A_Current_Affair›.---. “Aboriginal Tent Embassy.” 2014. 19 Sep. 2014 ‹http://en.wikipedia.org/wiki/Aboriginal_Tent_Embassy›.---. “Department of Families, Housing, Community Services and Indigenous Affairs.” 2014. 19 Sep. 2014 ‹http://en.wikipedia.org/wiki/Department_of_Families,_Housing,_Community_Services_and_Indigenous_Affairs›.---. “Eddie Mabo.” 2014. 19 Sep. 2014 ‹http://en.wikipedia.org/wiki/Eddie_Mabo›.---. “History of Australia (1788 – 1850).” 2014. 19 Sep. 2014 ‹http://en.wikipedia.org/wiki/History_of_Australia_(1788%E2%80%931850)#Aboriginal_resistance›.---. “Terra Nullius.” 2014. 19 Sep. 2014 ‹http://en.wikipedia.org/wiki/Terra_nullius›.

49

Currie, Susan, and Donna Lee Brien. "Mythbusting Publishing: Questioning the ‘Runaway Popularity’ of Published Biography and Other Life Writing." M/C Journal 11, no.4 (July1, 2008). http://dx.doi.org/10.5204/mcj.43.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Introduction: Our current obsession with the lives of others “Biography—that is to say, our creative and non-fictional output devoted to recording and interpreting real lives—has enjoyed an extraordinary renaissance in recent years,” writes Nigel Hamilton in Biography: A Brief History (1). Ian Donaldson agrees that biography is back in fashion: “Once neglected within the academy and relegated to the dustier recesses of public bookstores, biography has made a notable return over recent years, emerging, somewhat surprisingly, as a new cultural phenomenon, and a new academic adventure” (23). For over a decade now, commentators having been making similar observations about our obsession with the intimacies of individual people’s lives. In a lecture in 1994, Justin Kaplan asserted the West was “a culture of biography” (qtd. in Salwak 1) and more recent research findings by John Feather and Hazel Woodbridge affirm that “the undiminished human curiosity about other peoples lives is clearly reflected in the popularity of autobiographies and biographies” (218). At least in relation to television, this assertion seems valid. In Australia, as in the USA and the UK, reality and other biographically based television shows have taken over from drama in both the numbers of shows produced and the viewers these shows attract, and these forms are also popular in Canada (see, for instance, Morreale on The Osbournes). In 2007, the program Biography celebrated its twentieth anniversary season to become one of the longest running documentary series on American television; so successful that in 1999 it was spun off into its own eponymous channel (Rak; Dempsey). Premiered in May 1996, Australian Story—which aims to utilise a “personal approach” to biographical storytelling—has won a significant viewership, critical acclaim and professional recognition (ABC). It can also be posited that the real home movies viewers submit to such programs as Australia’s Favourite Home Videos, and “chat” or “confessional” television are further reflections of a general mania for biographical detail (see Douglas), no matter how fragmented, sensationalized, or even inane and cruel. A recent example of the latter, the USA-produced The Moment of Truth, has contestants answering personal questions under polygraph examination and then again in front of an audience including close relatives and friends—the more “truthful” their answers (and often, the more humiliated and/or distressed contestants are willing to be), the more money they can win. Away from television, but offering further evidence of this interest are the growing readerships for personally oriented weblogs and networking sites such as MySpace and Facebook (Grossman), individual profiles and interviews in periodical publications, and the recently widely revived newspaper obituary column (Starck). Adult and community education organisations run short courses on researching and writing auto/biographical forms and, across Western countries, the family history/genealogy sections of many local, state, and national libraries have been upgraded to meet the increasing demand for these services. Academically, journals and e-mail discussion lists have been established on the topics of biography and autobiography, and North American, British, and Australian universities offer undergraduate and postgraduate courses in life writing. The commonly aired wisdom is that published life writing in its many text-based forms (biography, autobiography, memoir, diaries, and collections of personal letters) is enjoying unprecedented popularity. It is our purpose to examine this proposition. Methodological problems There are a number of problems involved in investigating genre popularity, growth, and decline in publishing. Firstly, it is not easy to gain access to detailed statistics, which are usually only available within the industry. Secondly, it is difficult to ascertain how publishing statistics are gathered and what they report (Eliot). There is the question of whether bestselling booklists reflect actual book sales or are manipulated marketing tools (Miller), although the move from surveys of booksellers to electronic reporting at point of sale in new publishing lists such as BookScan will hopefully obviate this problem. Thirdly, some publishing lists categorise by subject and form, some by subject only, and some do not categorise at all. This means that in any analysis of these statistics, a decision has to be made whether to use the publishing list’s system or impose a different mode. If the publishing list is taken at face value, the question arises of whether to use categorisation by form or by subject. Fourthly, there is the bedeviling issue of terminology. Traditionally, there reigned a simple dualism in the terminology applied to forms of telling the true story of an actual life: biography and autobiography. Publishing lists that categorise their books, such as BookScan, have retained it. But with postmodern recognition of the presence of the biographer in a biography and of the presence of other subjects in an autobiography, the dichotomy proves false. There is the further problem of how to categorise memoirs, diaries, and letters. In the academic arena, the term “life writing” has emerged to describe the field as a whole. Within the genre of life writing, there are, however, still recognised sub-genres. Academic definitions vary, but generally a biography is understood to be a scholarly study of a subject who is not the writer; an autobiography is the story of a entire life written by its subject; while a memoir is a segment or particular focus of that life told, again, by its own subject. These terms are, however, often used interchangeably even by significant institutions such the USA Library of Congress, which utilises the term “biography” for all. Different commentators also use differing definitions. Hamilton uses the term “biography” to include all forms of life writing. Donaldson discusses how the term has been co-opted to include biographies of place such as Peter Ackroyd’s London: The Biography (2000) and of things such as Lizzie Collingham’s Curry: A Biography (2005). This reflects, of course, a writing/publishing world in which non-fiction stories of places, creatures, and even foodstuffs are called biographies, presumably in the belief that this will make them more saleable. The situation is further complicated by the emergence of hybrid publishing forms such as, for instance, the “memoir-with-recipes” or “food memoir” (Brien, Rutherford and Williamson). Are such books to be classified as autobiography or put in the “cookery/food & drink” category? We mention in passing the further confusion caused by novels with a subtitle of The Biography such as Virginia Woolf’s Orlando. The fifth methodological problem that needs to be mentioned is the increasing globalisation of the publishing industry, which raises questions about the validity of the majority of studies available (including those cited herein) which are nationally based. Whether book sales reflect what is actually read (and by whom), raises of course another set of questions altogether. Methodology In our exploration, we were fundamentally concerned with two questions. Is life writing as popular as claimed? And, if it is, is this a new phenomenon? To answer these questions, we examined a range of available sources. We began with the non-fiction bestseller lists in Publishers Weekly (a respected American trade magazine aimed at publishers, librarians, booksellers, and literary agents that claims to be international in scope) from their inception in 1912 to the present time. We hoped that this data could provide a longitudinal perspective. The term bestseller was coined by Publishers Weekly when it began publishing its lists in 1912; although the first list of popular American books actually appeared in The Bookman (New York) in 1895, based itself on lists appearing in London’s The Bookman since 1891 (Bassett and Walter 206). The Publishers Weekly lists are the best source of longitudinal information as the currently widely cited New York Times listings did not appear till 1942, with the Wall Street Journal a late entry into the field in 1994. We then examined a number of sources of more recent statistics. We looked at the bestseller lists from the USA-based Amazon.com online bookseller; recent research on bestsellers in Britain; and lists from Nielsen BookScan Australia, which claims to tally some 85% or more of books sold in Australia, wherever they are published. In addition to the reservations expressed above, caveats must be aired in relation to these sources. While Publishers Weekly claims to be an international publication, it largely reflects the North American publishing scene and especially that of the USA. Although available internationally, Amazon.com also has its own national sites—such as Amazon.co.uk—not considered here. It also caters to a “specific computer-literate, credit-able clientele” (Gutjahr: 219) and has an unashamedly commercial focus, within which all the information generated must be considered. In our analysis of the material studied, we will use “life writing” as a genre term. When it comes to analysis of the lists, we have broken down the genre of life writing into biography and autobiography, incorporating memoir, letters, and diaries under autobiography. This is consistent with the use of the terminology in BookScan. Although we have broken down the genre in this way, it is the overall picture with regard to life writing that is our concern. It is beyond the scope of this paper to offer a detailed analysis of whether, within life writing, further distinctions should be drawn. Publishers Weekly: 1912 to 2006 1912 saw the first list of the 10 bestselling non-fiction titles in Publishers Weekly. It featured two life writing texts, being headed by an autobiography, The Promised Land by Russian Jewish immigrant Mary Antin, and concluding with Albert Bigelow Paine’s six-volume biography, Mark Twain. The Publishers Weekly lists do not categorise non-fiction titles by either form or subject, so the classifications below are our own with memoir classified as autobiography. In a decade-by-decade tally of these listings, there were 3 biographies and 20 autobiographies in the lists between 1912 and 1919; 24 biographies and 21 autobiographies in the 1920s; 13 biographies and 40 autobiographies in the 1930s; 8 biographies and 46 biographies in the 1940s; 4 biographies and 14 autobiographies in the 1950s; 11 biographies and 13 autobiographies in the 1960s; 6 biographies and 11 autobiographies in the 1970s; 3 biographies and 19 autobiographies in the 1980s; 5 biographies and 17 autobiographies in the 1990s; and 2 biographies and 7 autobiographies from 2000 up until the end of 2006. See Appendix 1 for the relevant titles and authors. Breaking down the most recent figures for 1990–2006, we find a not radically different range of figures and trends across years in the contemporary environment. The validity of looking only at the top ten books sold in any year is, of course, questionable, as are all the issues regarding sources discussed above. But one thing is certain in terms of our inquiry. There is no upwards curve obvious here. If anything, the decade break-down suggests that sales are trending downwards. This is in keeping with the findings of Michael Korda, in his history of twentieth-century bestsellers. He suggests a consistent longitudinal picture across all genres: In every decade, from 1900 to the end of the twentieth century, people have been reliably attracted to the same kind of books […] Certain kinds of popular fiction always do well, as do diet books […] self-help books, celebrity memoirs, sensationalist scientific or religious speculation, stories about pets, medical advice (particularly on the subjects of sex, longevity, and child rearing), folksy wisdom and/or humour, and the American Civil War (xvii). Amazon.com since 2000 The USA-based Amazon.com online bookselling site provides listings of its own top 50 bestsellers since 2000, although only the top 14 bestsellers are recorded for 2001. As fiction and non-fiction are not separated out on these lists and no genre categories are specified, we have again made our own decisions about what books fall into the category of life writing. Generally, we erred on the side of inclusion. (See Appendix 2.) However, when it came to books dealing with political events, we excluded books dealing with specific aspects of political practice/policy. This meant excluding books on, for instance, George Bush’s so-called ‘war on terror,’ of which there were a number of bestsellers listed. In summary, these listings reveal that of the top 364 books sold by Amazon from 2000 to 2007, 46 (or some 12.6%) were, according to our judgment, either biographical or autobiographical texts. This is not far from the 10% of the 1912 Publishers Weekly listing, although, as above, the proportion of bestsellers that can be classified as life writing varied dramatically from year to year, with no discernible pattern of peaks and troughs. This proportion tallied to 4% auto/biographies in 2000, 14% in 2001, 10% in 2002, 18% in 2003 and 2004, 4% in 2005, 14% in 2006 and 20% in 2007. This could suggest a rising trend, although it does not offer any consistent trend data to suggest sales figures may either continue to grow, or fall again, in 2008 or afterwards. Looking at the particular texts in these lists (see Appendix 2) also suggests that there is no general trend in the popularity of life writing in relation to other genres. For instance, in these listings in Amazon.com, life writing texts only rarely figure in the top 10 books sold in any year. So rarely indeed, that from 2001 there were only five in this category. In 2001, John Adams by David McCullough was the best selling book of the year; in 2003, Hillary Clinton’s autobiographical Living History was 7th; in 2004, My Life by Bill Clinton reached number 1; in 2006, Nora Ephron’s I Feel Bad About My Neck: and Other Thoughts on Being a Woman was 9th; and in 2007, Ishmael Beah’s discredited A Long Way Gone: Memoirs of a Boy Soldier came in at 8th. Apart from McCulloch’s biography of Adams, all the above are autobiographical texts, while the focus on leading political figures is notable. Britain: Feather and Woodbridge With regard to the British situation, we did not have actual lists and relied on recent analysis. John Feather and Hazel Woodbridge find considerably higher levels for life writing in Britain than above with, from 1998 to 2005, 28% of British published non-fiction comprising autobiography, while 8% of hardback and 5% of paperback non-fiction was biography (2007). Furthermore, although Feather and Woodbridge agree with commentators that life writing is currently popular, they do not agree that this is a growth state, finding the popularity of life writing “essentially unchanged” since their previous study, which covered 1979 to the early 1990s (Feather and Reid). Australia: Nielsen BookScan 2006 and 2007 In the Australian publishing industry, where producing books remains an ‘expensive, risky endeavour which is increasingly market driven’ (Galligan 36) and ‘an inherently complex activity’ (Carter and Galligan 4), the most recent Australian Bureau of Statistics figures reveal that the total numbers of books sold in Australia has remained relatively static over the past decade (130.6 million in the financial year 1995–96 and 128.8 million in 2003–04) (ABS). During this time, however, sales volumes of non-fiction publications have grown markedly, with a trend towards “non-fiction, mass market and predictable” books (Corporall 41) resulting in general non-fiction sales in 2003–2004 outselling general fiction by factors as high as ten depending on the format—hard- or paperback, and trade or mass market paperback (ABS 2005). However, while non-fiction has increased in popularity in Australia, the same does not seem to hold true for life writing. Here, in utilising data for the top 5,000 selling non-fiction books in both 2006 and 2007, we are relying on Nielsen BookScan’s categorisation of texts as either biography or autobiography. In 2006, no works of life writing made the top 10 books sold in Australia. In looking at the top 100 books sold for 2006, in some cases the subjects of these works vary markedly from those extracted from the Amazon.com listings. In Australia in 2006, life writing makes its first appearance at number 14 with convicted drug smuggler Schapelle Corby’s My Story. This is followed by another My Story at 25, this time by retired Australian army chief, Peter Cosgrove. Jonestown: The Power and Myth of Alan Jones comes in at 34 for the Australian broadcaster’s biographer Chris Masters; the biography, The Innocent Man by John Grisham at 38 and Li Cunxin’s autobiographical Mao’s Last Dancer at 45. Australian Susan Duncan’s memoir of coping with personal loss, Salvation Creek: An Unexpected Life makes 50; bestselling USA travel writer Bill Bryson’s autobiographical memoir of his childhood The Life and Times of the Thunderbolt Kid 69; Mandela: The Authorised Portrait by Rosalind Coward, 79; and Joanne Lees’s memoir of dealing with her kidnapping, the murder of her partner and the justice system in Australia’s Northern Territory, No Turning Back, 89. These books reveal a market preference for autobiographical writing, and an almost even split between Australian and overseas subjects in 2006. 2007 similarly saw no life writing in the top 10. The books in the top 100 sales reveal a downward trend, with fewer titles making this band overall. In 2007, Terri Irwin’s memoir of life with her famous husband, wildlife warrior Steve Irwin, My Steve, came in at number 26; musician Andrew Johns’s memoir of mental illness, The Two of Me, at 37; Ayaan Hirst Ali’s autobiography Infidel at 39; John Grogan’s biography/memoir, Marley and Me: Life and Love with the World’s Worst Dog, at 42; Sally Collings’s biography of the inspirational young survivor Sophie Delezio, Sophie’s Journey, at 51; and Elizabeth Gilbert’s hybrid food, self-help and travel memoir, Eat, Pray, Love: One Woman’s Search for Everything at 82. Mao’s Last Dancer, published the year before, remained in the top 100 in 2007 at 87. When moving to a consideration of the top 5,000 books sold in Australia in 2006, BookScan reveals only 62 books categorised as life writing in the top 1,000, and only 222 in the top 5,000 (with 34 titles between 1,000 and 1,999, 45 between 2,000 and 2,999, 48 between 3,000 and 3,999, and 33 between 4,000 and 5,000). 2007 shows a similar total of 235 life writing texts in the top 5,000 bestselling books (75 titles in the first 1,000, 27 between 1,000 and 1,999, 51 between 2,000 and 2,999, 39 between 3,000 and 3,999, and 43 between 4,000 and 5,000). In both years, 2006 and 2007, life writing thus not only constituted only some 4% of the bestselling 5,000 titles in Australia, it also showed only minimal change between these years and, therefore, no significant growth. Conclusions Our investigation using various instruments that claim to reflect levels of book sales reveals that Western readers’ willingness to purchase published life writing has not changed significantly over the past century. We find no evidence of either a short, or longer, term growth or boom in sales in such books. Instead, it appears that what has been widely heralded as a new golden age of life writing may well be more the result of an expanded understanding of what is included in the genre than an increased interest in it by either book readers or publishers. What recent years do appear to have seen, however, is a significantly increased interest by public commentators, critics, and academics in this genre of writing. We have also discovered that the issue of our current obsession with the lives of others tends to be discussed in academic as well as popular fora as if what applies to one sub-genre or production form applies to another: if biography is popular, then autobiography will also be, and vice versa. If reality television programming is attracting viewers, then readers will be flocking to life writing as well. Our investigation reveals that such propositions are questionable, and that there is significant research to be completed in mapping such audiences against each other. This work has also highlighted the difficulty of separating out the categories of written texts in publishing studies, firstly in terms of determining what falls within the category of life writing as distinct from other forms of non-fiction (the hybrid problem) and, secondly, in terms of separating out the categories within life writing. Although we have continued to use the terms biography and autobiography as sub-genres, we are aware that they are less useful as descriptors than they are often assumed to be. In order to obtain a more complete and accurate picture, publishing categories may need to be agreed upon, redefined and utilised across the publishing industry and within academia. This is of particular importance in the light of the suggestions (from total sales volumes) that the audiences for books are limited, and therefore the rise of one sub-genre may be directly responsible for the fall of another. Bair argues, for example, that in the 1980s and 1990s, the popularity of what she categorises as memoir had direct repercussions on the numbers of birth-to-death biographies that were commissioned, contracted, and published as “sales and marketing staffs conclude[d] that readers don’t want a full-scale life any more” (17). Finally, although we have highlighted the difficulty of using publishing statistics when there is no common understanding as to what such data is reporting, we hope this study shows that the utilisation of such material does add a depth to such enquiries, especially in interrogating the anecdotal evidence that is often quoted as data in publishing and other studies. Appendix 1 Publishers Weekly listings 1990–1999 1990 included two autobiographies, Bo Knows Bo by professional athlete Bo Jackson (with Dick Schaap) and Ronald Reagan’s An America Life: An Autobiography. In 1991, there were further examples of life writing with unimaginative titles, Me: Stories of My Life by Katherine Hepburn, Nancy Reagan: The Unauthorized Biography by Kitty Kelley, and Under Fire: An American Story by Oliver North with William Novak; as indeed there were again in 1992 with It Doesn’t Take a Hero: The Autobiography of Norman Schwarzkopf, Sam Walton: Made in America, the autobiography of the founder of Wal-Mart, Diana: Her True Story by Andrew Morton, Every Living Thing, yet another veterinary outpouring from James Herriot, and Truman by David McCullough. In 1993, radio shock-jock Howard Stern was successful with the autobiographical Private Parts, as was Betty Eadie with her detailed recounting of her alleged near-death experience, Embraced by the Light. Eadie’s book remained on the list in 1994 next to Don’t Stand too Close to a Naked Man, comedian Tim Allen’s autobiography. Flag-waving titles continue in 1995 with Colin Powell’s My American Journey, and Miss America, Howard Stern’s follow-up to Private Parts. 1996 saw two autobiographical works, basketball superstar Dennis Rodman’s Bad as I Wanna Be and figure-skater, Ekaterina Gordeeva’s (with EM Swift) My Sergei: A Love Story. In 1997, Diana: Her True Story returns to the top 10, joining Frank McCourt’s Angela’s Ashes and prolific biographer Kitty Kelly’s The Royals, while in 1998, there is only the part-autobiography, part travel-writing A Pirate Looks at Fifty, by musician Jimmy Buffet. There is no biography or autobiography included in either the 1999 or 2000 top 10 lists in Publishers Weekly, nor in that for 2005. In 2001, David McCullough’s biography John Adams and Jack Welch’s business memoir Jack: Straight from the Gut featured. In 2002, Let’s Roll! Lisa Beamer’s tribute to her husband, one of the heroes of 9/11, written with Ken Abraham, joined Rudolph Giuliani’s autobiography, Leadership. 2003 saw Hillary Clinton’s autobiography Living History and Paul Burrell’s memoir of his time as Princess Diana’s butler, A Royal Duty, on the list. In 2004, it was Bill Clinton’s turn with My Life. In 2006, we find John Grisham’s true crime (arguably a biography), The Innocent Man, at the top, Grogan’s Marley and Me at number three, and the autobiographical The Audacity of Hope by Barack Obama in fourth place. Appendix 2 Amazon.com listings since 2000 In 2000, there were only two auto/biographies in the top Amazon 50 bestsellers with Lance Armstrong’s It’s Not about the Bike: My Journey Back to Life about his battle with cancer at 20, and Dave Eggers’s self-consciously fictionalised memoir, A Heartbreaking Work of Staggering Genius at 32. In 2001, only the top 14 bestsellers were recorded. At number 1 is John Adams by David McCullough and, at 11, Jack: Straight from the Gut by USA golfer Jack Welch. In 2002, Leadership by Rudolph Giuliani was at 12; Master of the Senate: The Years of Lyndon Johnson by Robert Caro at 29; Portrait of a Killer: Jack the Ripper by Patricia Cornwell at 42; Blinded by the Right: The Conscience of an Ex-Conservative by David Brock at 48; and Louis Gerstner’s autobiographical Who Says Elephants Can’t Dance: Inside IBM’s Historic Turnaround at 50. In 2003, Living History by Hillary Clinton was 7th; Benjamin Franklin: An American Life by Walter Isaacson 14th; Dereliction of Duty: The Eyewitness Account of How President Bill Clinton Endangered America’s Long-Term National Security by Robert Patterson 20th; Under the Banner of Heaven: A Story of Violent Faith by Jon Krakauer 32nd; Leap of Faith: Memoirs of an Unexpected Life by Queen Noor of Jordan 33rd; Kate Remembered, Scott Berg’s biography of Katharine Hepburn, 37th; Who’s your Caddy?: Looping for the Great, Near Great and Reprobates of Golf by Rick Reilly 39th; The Teammates: A Portrait of a Friendship about a winning baseball team by David Halberstam 42nd; and Every Second Counts by Lance Armstrong 49th. In 2004, My Life by Bill Clinton was the best selling book of the year; American Soldier by General Tommy Franks was 16th; Kevin Phillips’s American Dynasty: Aristocracy, Fortune and the Politics of Deceit in the House of Bush 18th; Timothy Russert’s Big Russ and Me: Father and Son. Lessons of Life 20th; Tony Hendra’s Father Joe: The Man who Saved my Soul 23rd; Ron Chernow’s Alexander Hamilton 27th; co*kie Roberts’s Founding Mothers: The Women Who Raised our Nation 31st; Kitty Kelley’s The Family: The Real Story of the Bush Dynasty 42nd; and Chronicles, Volume 1 by Bob Dylan was 43rd. In 2005, auto/biographical texts were well down the list with only The Year of Magical Thinking by Joan Didion at 45 and The Glass Castle: A Memoir by Jeanette Walls at 49. In 2006, there was a resurgence of life writing with Nora Ephron’s I Feel Bad About My Neck: and Other Thoughts on Being a Woman at 9; Grisham’s The Innocent Man at 12; Bill Buford’s food memoir Heat: an Amateur’s Adventures as Kitchen Slave, Line Cook, Pasta-Maker, and Apprentice to a Dante-Quoting Butcher in Tuscany at 23; more food writing with Julia Child’s My Life in France at 29; Immaculée Ilibagiza’s Left to Tell: Discovering God amidst the Rwandan Holocaust at 30; CNN anchor Anderson Cooper’s Dispatches from the Edge: A Memoir of War, Disasters and Survival at 43; and Isabella Hatkoff’s Owen & Mzee: The True Story of a Remarkable Friendship (between a baby hippo and a giant tortoise) at 44. In 2007, Ishmael Beah’s discredited A Long Way Gone: Memoirs of a Boy Soldier came in at 8; Walter Isaacson’s Einstein: His Life and Universe 13; Ayaan Hirst Ali’s autobiography of her life in Muslim society, Infidel, 18; The Reagan Diaries 25; Jesus of Nazareth by Pope Benedict XVI 29; Mother Teresa: Come be my Light 36; Clapton: The Autobiography 40; Tina Brown’s The Diana Chronicles 45; Tony Dungy’s Quiet Strength: The Principles, Practices & Priorities of a Winning Life 47; and Daniel Tammet’s Born on a Blue Day: Inside the Extraordinary Mind of an Autistic Savant at 49. Acknowledgements A sincere thank you to Michael Webster at RMIT for assistance with access to Nielsen BookScan statistics, and to the reviewers of this article for their insightful comments. Any errors are, of course, our own. References Australian Broadcasting Commission (ABC). “About Us.” Australian Story 2008. 1 June 2008. ‹http://www.abc.net.au/austory/aboutus.htm>. Australian Bureau of Statistics. “1363.0 Book Publishers, Australia, 2003–04.” 2005. 1 June 2008 ‹http://www.abs.gov.au/ausstats/abs@.nsf/mf/1363.0>. Bair, Deirdre “Too Much S & M.” Sydney Morning Herald 10–11 Sept. 2005: 17. Basset, Troy J., and Christina M. Walter. “Booksellers and Bestsellers: British Book Sales as Documented by The Bookman, 1891–1906.” Book History 4 (2001): 205–36. Brien, Donna Lee, Leonie Rutherford, and Rosemary Williamson. “Hearth and Hotmail: The Domestic Sphere as Commodity and Community in Cyberspace.” M/C Journal 10.4 (2007). 1 June 2008 ‹http://journal.media-culture.org.au/0708/10-brien.php>. Carter, David, and Anne Galligan. “Introduction.” Making Books: Contemporary Australian Publishing. St Lucia: U of Queensland P, 2007. 1–14. Corporall, Glenda. Project Octopus: Report Commissioned by the Australian Society of Authors. Sydney: Australian Society of Authors, 1990. Dempsey, John “Biography Rewrite: A&E’s Signature Series Heads to Sib Net.” Variety 4 Jun. 2006. 1 June 2008 ‹http://www.variety.com/article/VR1117944601.html?categoryid=1238&cs=1>. Donaldson, Ian. “Matters of Life and Death: The Return of Biography.” Australian Book Review 286 (Nov. 2006): 23–29. Douglas, Kate. “‘Blurbing’ Biographical: Authorship and Autobiography.” Biography 24.4 (2001): 806–26. Eliot, Simon. “Very Necessary but not Sufficient: A Personal View of Quantitative Analysis in Book History.” Book History 5 (2002): 283–93. Feather, John, and Hazel Woodbridge. “Bestsellers in the British Book Industry.” Publishing Research Quarterly 23.3 (Sept. 2007): 210–23. Feather, JP, and M Reid. “Bestsellers and the British Book Industry.” Publishing Research Quarterly 11.1 (1995): 57–72. Galligan, Anne. “Living in the Marketplace: Publishing in the 1990s.” Publishing Studies 7 (1999): 36–44. Grossman, Lev. “Time’s Person of the Year: You.” Time 13 Dec. 2006. Online edition. 1 June 2008 ‹http://www.time.com/time/magazine/article/0%2C9171%2C1569514%2C00.html>. Gutjahr, Paul C. “No Longer Left Behind: Amazon.com, Reader Response, and the Changing Fortunes of the Christian Novel in America.” Book History 5 (2002): 209–36. Hamilton, Nigel. Biography: A Brief History. Cambridge, MA: Harvard UP, 2007. Kaplan, Justin. “A Culture of Biography.” The Literary Biography: Problems and Solutions. Ed. Dale Salwak. Basingstoke: Macmillan, 1996. 1–11. Korda, Michael. Making the List: A Cultural History of the American Bestseller 1900–1999. New York: Barnes & Noble, 2001. Miller, Laura J. “The Bestseller List as Marketing Tool and Historical Fiction.” Book History 3 (2000): 286–304. Morreale, Joanne. “Revisiting The Osbournes: The Hybrid Reality-Sitcom.” Journal of Film and Video 55.1 (Spring 2003): 3–15. Rak, Julie. “Bio-Power: CBC Television’s Life & Times and A&E Network’s Biography on A&E.” LifeWriting 1.2 (2005): 1–18. Starck, Nigel. “Capturing Life—Not Death: A Case For Burying The Posthumous Parallax.” Text: The Journal of the Australian Association of Writing Programs 5.2 (2001). 1 June 2008 ‹http://www.textjournal.com.au/oct01/starck.htm>.

50

Felton, Emma. "Brisbane: Urban Construction, Suburban Dreaming." M/C Journal 14, no.4 (August22, 2011). http://dx.doi.org/10.5204/mcj.376.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

When historian Graeme Davison famously declared that “Australia was born urban and quickly grew suburban” (98), he was clearly referring to Melbourne or Sydney, but certainly not Brisbane. Although the Brisbane of 2011 might resemble a contemporary, thriving metropolis, its genealogy is not an urban one. For most of its history, as Gillian Whitlock has noted, Brisbane was “a place where urban industrial society is kept at bay” (80). What distinguishes Brisbane from Australia’s larger southern capital cities is its rapid morphology into a city from a provincial, suburban, town. Indeed it is Brisbane’s distinctive regionalism, with its sub-tropical climate, offering a steamy, fecund backdrop to narratives of the city that has produced a plethora of writing in literary accounts of the city, from author David Malouf through to contemporary writers such as Andrew McGahan, John Birmingham, Venero Armanno, Susan Johnson, and Nick Earls. Brisbane’s lack of urban tradition makes its transformation unique among Australian cities. Its rapid population growth and urban development have changed the way that many people now live in the city. Unlike the larger cities of Sydney or Melbourne, whose inner cities were established on the Victorian model of terrace-row housing on small lots, Brisbane’s early planners eschewed this approach. So, one of the features that gives the city its distinction is the languorous suburban quality of its inner-city areas, where many house blocks are the size of the suburban quarter-acre block, all within coo-ee of the city centre. Other allotments are medium to small in size, and, until recently, housed single dwellings of varying sizes and grandeur. Add to this a sub-tropical climate in which ‘green and growth’ is abundant and the pretty but flimsy timber vernacular housing, and it’s easy to imagine that you might be many kilometres from a major metropolitan centre as you walk around Brisbane’s inner city areas. It is partly this feature that prompted demographer Bernard Salt to declare Brisbane “Australia’s most suburban city” (Salt 5). Prior to urban renewal in the early 1990s, Brisbane was a low-density town with very few apartment blocks; most people lived in standalone houses.From the inception of the first Urban Renewal program in 1992, a joint initiative of the Federal government’s Building Better Cities Program and managed by the Brisbane City Council (BCC), Brisbane’s urban development has undergone significant change. In particular, the city’s Central Business District (CBD) and inner city have experienced intense development and densification with a sharp rise in medium- to high-density apartment dwellings to accommodate the city’s swelling population. Population growth has added to the demand for increased density, and from the period 1995–2006 Brisbane was Australia’s fastest growing city (ABS).Today, parts of Brisbane’s inner city resembles the density of the larger cities of Melbourne and Sydney. Apartment blocks have mushroomed along the riverfront and throughout inner and middle ring suburbs. Brisbane’s population has enthusiastically embraced apartment living, with “empty nesters” leaving their suburban family homes for the city, and apartments have become the affordable option for renters and first home purchasers. A significant increase in urban amenities such as large-scale parklands and river side boardwalks, and a growth in service industries such as cafes, restaurants and bars—a feature of cities the world over—have contributed to the appeal of the city and the changing way that people live in Brisbane.Urbanism demands specific techniques of living—life is different in medium- to high-density dwellings, in populous places, where people live in close proximity to one another. In many ways it’s the antithesis to suburban life, a way of living that, as Davison notes, was established around an ethos of privacy, health, and seclusion and is exemplified in the gated communities seen in the suburbs today. The suburbs are characterised by generosity of space and land, and developed as a refuge and escape from the city, a legacy of the nineteenth-century industrial city’s connection with overcrowding, disease, and disorder. Suburban living flourished in Australia from the eighteenth century and Davison notes how, when Governor Phillip drew up the first town plan for Sydney in 1789, it embodied the aspirations of “decency, good order, health and domestic privacy,” which lie at the heart of suburban ideals (100).The health and moral impetus underpinning the establishment of suburban life—that is, to remove people from overcrowding and the unhygienic conditions of slums—for Davison meant that the suburban ethos was based on a “logic of avoidance” (110). Attempting to banish anything deemed dangerous and offensive, the suburbs were seen to offer a more natural, orderly, and healthy environment. A virtuous and happy life required plenty of room—thus, a garden and the expectation of privacy was paramount.The suburbs as a site of lived experience and cultural meaning is significant for understanding the shift from suburban living to the adoption of medium- to high-density inner-city living in Brisbane. I suggest that the ways in which this shift is captured discursively, particularly in promotional material, are indicative of the suburbs' stronghold on the collective imagination. Reinforcing this perception of Brisbane as a suburban city is a history of literary narratives that have cast Brisbane in ways that set it apart from other Australian cities, and that are to do with its non-urban characteristics. Imaginative and symbolic discourses of place have real and material consequences (Lefebvre), as advertisers are only too well aware. Discursively, city life has been imagined oppositionally from life in the suburbs: the two sites embody different cultural meanings and values. In Australia, the suburbs are frequently a site of derision and satire, characterized as bastions of conformity and materialism (Horne), offering little of value in contrast to the city’s many enchantments and diverse pleasures. In the well-established tradition of satire, “suburban bashing is replete in literature, film and popular culture” (Felton et al xx). From Barry Humphries’s characterisation of Dame Edna Everage, housewife superstar, who first appeared in the 1960s, to the recent television comedy series Kath and Kim, suburbia and its inhabitants are represented as dull-witted, obsessed with trivia, and unworldly. This article does not intend to rehearse the tradition of suburban lampooning; rather, it seeks to illustrate how ideas about suburban living are hard held and how the suburban ethos maintains its grip, particularly in relation to notions of privacy and peace, despite the celebratory discourse around the emerging forms of urbanism in Brisbane.As Brisbane morphed rapidly from a provincial, suburban town to a metropolis throughout the 1990s and early 2000s, a set of metropolitan discourses developed in the local media that presented new ways of inhabiting and imagining the city and offered new affiliations and identifications with the city. In establishing Brisbane’s distinction as a city, marketing material relied heavily on the opposition between the city and the suburbs, implying that urban vitality and diversity rules triumphant over the suburbs’ apparent dullness and hom*ogeneity. In a billboard advertisem*nt for apartments in the urban renewal area of Newstead (2004), images of architectural renderings of the apartments were anchored by the words—“Urban living NOT suburban”—leaving little room for doubt. It is not the design qualities of the apartments or the building itself being promoted here, but a way of life that alludes to utopian ideas of urban life, of enchantment with the city, and implies, with the heavy emphasis of “NOT suburban,” the inferiority of suburban living.The cultural commodification of the late twentieth- and twenty-first-century city has been well documented (Evans; Dear; Zukin; Harvey) and its symbolic value as a commodity is expressed in marketing literature via familiar metropolitan tropes that are frequently amorphous and international. The malleability of such images makes them easily transportable and transposable, and they provided a useful stockpile for promoting a city such as Brisbane that lacked its own urban resources with which to construct a new identity. In the early days of urban renewal, the iconic images and references to powerhouse cities such as New York, London, and even Venice were heavily relied upon. In the latter example, an advertisem*nt promoting Brisbane appeared in the Sydney Morning Herald colour magazine (May 2005). This advertisem*nt represented Brisbane as an antipodean Venice, showing a large reach of the Brisbane river replete with gondolas flanked by the city’s only nineteenth-century riverside building, the Custom’s House. The allusion to traditional European culture is a departure from the usual tropes of “fun and sun” associated with promotions of Queensland, including Brisbane, while the new approach to promoting Brisbane is cognizant of the value of culture in the symbolic and economic hierarchy of the contemporary city. Perhaps equally, the advertisem*nt could be read as ironic, a postmodern self-parodying statement about the city in general. In a nod to the centrality of the spectacle, the advertisem*nt might be a salute to idea of the city as theme park, a pleasure playground and a collective fantasy of escape. Nonetheless, either interpretation presents Brisbane as somewhere else.In other promotional literature for apartment dwellings, suburban living maintains its imaginative grip, evident in a brochure advertising Petrie Point apartments in Brisbane’s urban renewal area of inner-city New Farm (2000). In the brochure, the promise of peace and calm—ideals that have their basis in suburban living—are imposed and promoted as a feature of inner-city living. Paradoxically, while suggesting that a wholesale evacuation and rejection of suburban life is occurring presumably because it is dull, the brochure simultaneously upholds the values of suburbia:Discerning baby boomers and generation X’ers who prefer lounging over latte rather than mowing the quarter acre block, are abandoning suburban living in droves. Instead, hankering after a more cosmopolitan lifestyle without the mind numbing drive to work, they are retreating to the residential mecca, the inner city, for chic shops and a lively dining, arts and theatre culture. (my italics)In the above extract, the rhetoric used to promote and uphold the virtues of a cosmopolitan inner-city life is sabotaged by a language that in many respects capitulates to the ideals of suburban living, and evokes the health and retreat ethos of suburbia. “Lounging” over lattes and “retreating to a residential mecca”[i] allude to precisely the type of suburban living the brochure purports to eschew. Privacy, relaxation, and health is a discourse and, more importantly, a way of living that is in many ways anathema to life in the city. It is a dream-wish that those features most valued about suburban life, can and should somehow be transplanted to the city. In its promotion of urban amenity, the brochure draws upon a somewhat bourgeois collection of cultural amenities and activities such as a (presumably traditional) arts and theatre culture, “lively dining,” and “chic” shops. The appeal to “discerning baby boomers and generation X’ers” has more than a whiff of status and class, an appeal that disavows the contemporary city’s attention to diversity and inclusivity, and frequently the source of promotion of many international cities. In contrast to the suburban sub-text of exclusivity and seclusion in the Petrie Point Apartment’s brochure, is a promotion of Sydney’s inner-city Newtown as a tourist site and spectacle, which makes an appeal to suburban antipathy clear from the outset. The brochure, distributed by NSW Tourism (2000) displays a strong emphasis on Newtown’s cultural and ethnic diversity, and the various forms of cultural consumption on offer. The inner-city suburb’s appeal is based on its re-framing as a site of tourist consumption of diversity and difference in which diversity is central to its performance as a tourist site. It relies on the distinction between “ordinary” suburbs and “cosmopolitan” places:Some cities are cursed with suburbs, but Sydney’s blessed with Newtown — a cosmopolitan neighbourhood of more than 600 stores, 70 restaurants, 42 cafes, theatres, pubs, and entertainment venues, all trading in two streets whose origins lie in the nineteenth century … Newtown is the Catwalk for those with more style than money … a parade where Yves St Laurent meets Saint Vincent de Paul, where Milano meets post-punk bohemia, where Max Mara meets Doc Marten, a stage where a petticoat is more likely to be your grandma’s than a Colette Dinnigan designer original (From Sydney Marketing brochure)Its opening oppositional gambit—“some cities are cursed with suburbs”—conveniently elides the fact that like all Australian cities, Sydney is largely suburban and many of Sydney’s suburbs are more ethnically diverse than its inner-city areas. Cabramatta, Fairfield, and most other suburbs have characteristically high numbers of ethnic groups such as Vietnamese, Korean, Lebanese, and so forth. Recent events, however, have helped to reframe these places as problem areas, rather than epicentres of diversity.The mingling of social groups invites the tourist-flâneur to a performance of difference, “a parade where Yves St Laurent meets Saint Vincent de Paul (my italics), where Milano meets post-punk bohemia,” and where “the upwardly mobile and down at heel” appear in what is presented as something of a theatrical extravaganza. Newtown is a product, its diversity a commodity. Consumed visually and corporeally via its divergent sights, sounds, smells and tastes (the brochure goes on to state that 70 restaurants offer cuisine from all over the globe), Newtown is a “successful neighbourhood experiment in the new globalism.” The area’s social inequities—which are implicit in the text, referred to as the “down at heel”—are vanquished and celebrated, incorporated into the rhetoric of difference.Brisbane’s lack of urban tradition and culture, as well as its lack of diversity in comparison to Sydney, reveals itself in the first brochure while the Newtown brochure appeals to the idea of a consumer-based cosmopolitanism. As a sociological concept, cosmopolitanism refers to a set of "subjective attitudes, outlooks and practices" broadly characterized as “disposition of openness towards others, people, things and experiences whose origin is non local” (Skrbis and Woodward 1). Clearly cosmopolitan attitudes do not have to be geographically located, but frequently the city is promoted as the site of these values, with the suburbs, apparently, forever looking inward.In the realm of marketing, appeals to the imagination are ubiquitous, but discursive practices can become embedded in everyday life. Despite the growth of urbanism, the increasing take up of metropolitan life and the enduring disdain among some for the suburbs, the hard-held suburban values of peace and privacy have pragmatic implications for the ways in which those values are embedded in people’s expectations of life in the inner city.The exponential growth in apartment living in Brisbane offers different ways of living to the suburban house. For a sub-tropical city where "life on the verandah" is a significant feature of the Queenslander house with its front and exterior verandahs, in the suburbs, a reasonable degree of privacy is assured. Much of Brisbane’s vernacular and contemporary housing is sensitive to this indoor-outdoor style of living, a distinct feature and appeal of everyday life in many suburbs. When "life on the verandah" is adapted to inner-city apartment buildings, expectations that indoor-outdoor living can be maintained in the same way can be problematic. In the inner city, life on the verandah may challenge expectations about privacy, noise and visual elements. While the Brisbane City Plan 2000 attempts to deal with privacy issues by mandating privacy screenings on verandahs, and the side screening of windows to prevent overlooking neighbours, there is ample evidence that attitudinal change is difficult. The exchange of a suburban lifestyle for an urban one, with the exposure to urbanity’s complexity, potential chaos and noise, can be confronting. In the Urban Renewal area and entertainment precinct of Fortitude Valley, during the late 1990s, several newly arrived residents mounted a vigorous campaign to the Brisbane City Council (BCC) and State government to have noise levels reduced from local nightclubs and bars. Fortitude Valley—the Valley, as it is known locally—had long been Brisbane’s main area for nightclubs, bars and brothels. A small precinct bounded by two major one-way roads, it was the locus of the infamous ABC 4 Corners “Moonlight State” report, which exposed the lines of corruption between politicians, police, and the judiciary of the former Bjelke-Petersen government (1974–1987) and who met in the Valley’s bars and brothels. The Valley was notorious for Brisbanites as the only place in a provincial, suburban town that resembled the seedy side of life associated with big cities. The BCC’s Urban Renewal Task Force and associated developers initially had a tough task convincing people that the area had been transformed. But as more amenity was established, and old buildings were converted to warehouse-style living in the pattern of gentrification the world over, people started moving in to the area from the suburbs and interstate (Felton). One of the resident campaigners against noise had purchased an apartment in the Sun Building, a former newspaper house and in which one of the apartment walls directly abutted the adjoining and popular nightclub, The Press Club. The Valley’s location as a music venue was supported by the BCC, who initially responded to residents’ noise complaints with its “loud and proud” campaign (Valley Metro). The focus of the campaign was to alert people moving into the newly converted apartments in the Valley to the existing use of the neighbourhood by musicians and music clubs. In another iteration of this campaign, the BCC worked with owners of music venues to ensure the area remains a viable music precinct while implementing restrictions on noise levels. Residents who objected to nightclub noise clearly failed to consider the impact of moving into an area that was already well known, even a decade ago, as the city’s premier precinct for music and entertainment venues. Since that time, the Valley has become Australia’s only regulated and promoted music precinct.The shift from suburban to urban living requires people to live in very different ways. Thrust into close proximity with strangers amongst a diverse population, residents can be confronted with a myriad of sensory inputs—to a cacophony of noise, sights, smells (Allon and Anderson). Expectations of order, retreat, and privacy inevitably come into conflict with urbanism’s inherent messiness. The contested nature of urban space is expressed in neighbour disputes, complaints about noise and visual amenity, and sometimes in eruptions of street violence. There is no shortage of examples in the Brisbane’s Urban Renewal areas such as Fortitude Valley, where acts of hom*ophobia, racism, and other less destructive conflicts continue to be a frequent occurrence. While the refashioned discursive Brisbane is re-presented as cool, cultured, and creative, the tensions of urbanism and tests to civility remain in a process of constant negotiation. This is the way the city’s past disrupts and resists its cool new surface.[i] The use of the word mecca in the brochure occurred prior to 11 September 2001.ReferencesAllon, Fiona, and Kay Anderson. "Sentient Sydney." In Passionate City: An International Symposium. Melbourne: RMIT, School of Media Communication, 2004. 89–97.Australian Bureau of Statistics (ABS). Regional Population Growth, Australia, 1996-2006.Birmingham, John. "The Lost City of Vegas: David Malouf’s Old Brisbane." Hot Iron Corrugated Sky. Ed. R. Sheahan-Bright and S. Glover. St Lucia: U of Queensland P, 2002. xx–xx.Davison, Graeme. "The Past and Future of the Australian Suburb." Suburban Dreaming: An Interdisciplinary Approach to Australian Cities. Ed. L. Johnson. Geelong: Deakin University Press, 1994. xx–xx.Dear, Michael. The Postmodern Urban Condition. Oxford: Blackwell, 2000.Evans, Graeme. “Hard-Branding the Cultural City—From Prado to Prada.” International Journal of Urban and Regional Research 27.2 (2003): 417–40.Evans, Raymond, and Carole Ferrier, eds. Radical Brisbane. Melbourne: The Vulgar Press, 2004.Felton, Emma, Christy Collis, and Phil Graham. “Making Connections: Creative Industries Networks in Outer Urban Locations.” Australian Geographer 14.1 (Mar. 2010): 57–70.Felton, Emma. Emerging Urbanism: A Social and Cultural Study of Urban Change in Brisbane. PhD thesis. Brisbane: Griffith University, 2007.Glover, Stuart, and Stuart Cunningham. "The New Brisbane." Artlink 23.2 (2003): 16–23. Harvey, David. The Condition of Postmodernity: An Enquiry into the Origins of Cultural Change. Cambridge, MA: Blackwell, 1990. Horne, Donald. The Lucky Country: Australia in the Sixties. Ringwood: Penguin, 1964.Lefebvre, Henri. The Production of Space. Oxford: Basil Blackwell, 1991.Malouf, David. Johnno. St Lucia: University of Queensland Press, 1975. ---. 12 Edmondstone Street. London: Penguin, 1986.NSW Tourism. Sydney City 2000. Sydney, 2000.Salt, Bernard. Cinderella City: A Vision of Brisbane’s Rise to Prominence. Sydney: Austcorp, 2005.Skrbis, Zlatko, and Ian Woodward. “The Ambivalence of Ordinary Cosmopolitanism: Investigating the Limits of Cosmopolitanism Openness.” Sociological Review (2007): 1-14.Valley Metro. 1 May 2011 < http://www.valleymetro.com.au/the_valley.aspx >.Whitlock, Gillian. “Queensland: The State of the Art on the 'Last Frontier.’" Westerly 29.2 (1984): 85–90.Zukin, Sharon. The Culture of Cities. Cambridge, MA: Basil Blackwell, 1995.

To the bibliography
Journal articles: 'Family Dog Productions' – Grafiati (2024)

References

Top Articles
Latest Posts
Article information

Author: Carmelo Roob

Last Updated:

Views: 5374

Rating: 4.4 / 5 (65 voted)

Reviews: 80% of readers found this page helpful

Author information

Name: Carmelo Roob

Birthday: 1995-01-09

Address: Apt. 915 481 Sipes Cliff, New Gonzalobury, CO 80176

Phone: +6773780339780

Job: Sales Executive

Hobby: Gaming, Jogging, Rugby, Video gaming, Handball, Ice skating, Web surfing

Introduction: My name is Carmelo Roob, I am a modern, handsome, delightful, comfortable, attractive, vast, good person who loves writing and wants to share my knowledge and understanding with you.